Transposon region | Oligo nucleotide | Sequence | Amplicon size (bp) | Transposon presumed present | S. pneumoniaepopulation screened | Reference |
---|---|---|---|---|---|---|
int gene | int_for | GCGTGATTGTATCTCACT | 1046 | Tn916 | Dual-positive, erm(B)-positive, mef(E)-positive | [29] |
 | int_rev | GACGCTCCTGTTGCTTCT |  |  |  | [29] |
xis gene | xis_for | AAGCAGACTGAGATTCCTA | 193 | Tn916 | Dual-positive, erm(B)-positive, mef(E)-positive | [29] |
 | xis rev | GCGTCCAATGTATCTATAA |  |  |  | [29] |
tnpRgene | O21 | CCAAGGAGCTAAAGAGGTCCC | 1528 | Tn917 | Dual-positive, erm(B)-positive, mef(E)-positive | [29] |
 | O22 | GTCCCGAGTCCCATGGAAGC |  |  |  | [29] |
tnpA gene | O23 | GCTTCCATGGGACTCGGGAC | 2115 | Tn917 | Dual-positive, erm(B)-positive, mef(E)-positive | [29] |
 | O24 | GCTCCCAATTAATAGGAGA |  |  |  | [29] |
Spans insert of erm(B) elements in Tn916 | J12d | ATTCCCATTGAAGACGCAGAAGT | 800 | Tn3872 | erm(B)-positive that are Tn916-positive | [34] |
 | J11d | CTACCGCACTTCGTTTGGTGTAC | 3600 | Tn6002 |  | [34] |
 |  |  | 7900 | Tn6003 or Tn1545 |  |  |
Junction of mega insert and Tn916 | SG1 | CTCACTGCACCAGAGGTGTA | 1000 | Tn2009 or Tn2010 | Dual-positive and mef(E)-positivie that are Tn916-positive | [30] |
 | LTf | GCAGAGTATACCATTCACATCGAAGTTCCAC |  |  |  | 30] |
Junction of erm(B) element and Tn916 | EB2 | AGTAATGGTACTTAAATTGTTTAC | 3300 | Tn2010 | Dual-positive that are Tn916-positive | [31] |
 | TN2a | GAAGTA(G/C)AAGCTAAAGATGG |  |  |  | [32] |