Skip to main content

Table 1 Oligonucleotides used in transposon detection

From: Dominance of multidrug resistant CC271 clones in macrolide-resistant Streptococcus pneumoniae in Arizona

Transposon region Oligo nucleotide Sequence Amplicon size (bp) Transposon presumed present S. pneumoniaepopulation screened Reference
int gene int_for GCGTGATTGTATCTCACT 1046 Tn916 Dual-positive, erm(B)-positive, mef(E)-positive [29]
  int_rev GACGCTCCTGTTGCTTCT     [29]
xis gene xis_for AAGCAGACTGAGATTCCTA 193 Tn916 Dual-positive, erm(B)-positive, mef(E)-positive [29]
  xis rev GCGTCCAATGTATCTATAA     [29]
tnpRgene O21 CCAAGGAGCTAAAGAGGTCCC 1528 Tn917 Dual-positive, erm(B)-positive, mef(E)-positive [29]
  O22 GTCCCGAGTCCCATGGAAGC     [29]
tnpA gene O23 GCTTCCATGGGACTCGGGAC 2115 Tn917 Dual-positive, erm(B)-positive, mef(E)-positive [29]
  O24 GCTCCCAATTAATAGGAGA     [29]
Spans insert of erm(B) elements in Tn916 J12d ATTCCCATTGAAGACGCAGAAGT 800 Tn3872 erm(B)-positive that are Tn916-positive [34]
  J11d CTACCGCACTTCGTTTGGTGTAC 3600 Tn6002   [34]
    7900 Tn6003 or Tn1545   
Junction of mega insert and Tn916 SG1 CTCACTGCACCAGAGGTGTA 1000 Tn2009 or Tn2010 Dual-positive and mef(E)-positivie that are Tn916-positive [30]
  LTf GCAGAGTATACCATTCACATCGAAGTTCCAC     30]
Junction of erm(B) element and Tn916 EB2 AGTAATGGTACTTAAATTGTTTAC 3300 Tn2010 Dual-positive that are Tn916-positive [31]
  TN2a GAAGTA(G/C)AAGCTAAAGATGG     [32]
  1. a Modified from original to change melt temperature or incorporate degeneracies