Skip to main content

Table 1 Primer pairs and probes used in this study

From: Isolation and characterization of Ehrlichia chaffeensis RNA polymerase and its use in evaluating p28 outer membrane protein gene promoters

Primers/probes Sequence 1Orientation Reference
For cloning p28-Omp14 and p28-Omp19promoters into pMT504
RRG217 (p28-Omp14) 5"-ttgctcaaccataaaataatggga F 25
RRG695 (p28-Omp14) 5"-taaaaatttaagaataatgaaag R This study
RRG185 (p28-Omp19)*# 5"-GACTCTAGActtttaattttattattgccacatg F 25
RRG696 (p28-Omp19) 5"-aaataaattaacaatagtagaag R This study
For cloning RpoD gene into pET32
RRG742* 5"-GAGCCATGGcttaacaaattctatattttccctaactc F This study
RRG743* 5"-CGCTCGAGttaactattgatattacaatgacctagt R This study
For TaqMan RT-PCR of test G-less transcripts
RRG766 5"-ccttcctccatctataccac F This study
RRG767 5"-gagagtgaatgatgatagatttg R This study
RRG765 (TaqMan Probe) 5"-cattattcctcctatcttctcctcttctc   This study
For TaqMan RT-PCR of control G-less transcripts
RRG769 5"-tactcacccaatactcccta F This study
RRG770 5"-gtggaatgagaaatgagtgt R This study
RRG768 (TaqMan Probe) 5"-cttatcctctcctcacctctccctc   This study
For sequencing pRG198
M13F-40 5"-gttttcccagtcacgac   Commercial
p28-Omp14 promoter EMSA probes
   Full length probe
RRG 217**   F  
RRG 218 5' gttaataaaccttttataaaag R 25
   Probe 1 (P1)
RRG217**   F  
RRG623 5"-ggtttagccattttaaatgtg R This study
   Probe 2 (P2)
RRG267 5"-cagttaactttctgtaaacttc F 25
RRG623 5"-ggtttagccattttaaatgtg R This study
   Probe 3 (P3)
RRG269 5"-cgttttctgctttattagaatg F 25
RRG625 5"-gtacatgcattatgagcaaatc R This study
   Probe 4 (P4)
RRG270 5"-gttccgtatttattaatatatg F 25
RRG626 5"-ctatacttaactttactactta R This study
   Probe 5 (P5)
RRG272 5"-ggataagtactttagcaagtgg F 25
RRG627 5"-gtctagaatataaaatttctttc R This study
p28-Omp19 promoter EMSA probes
   Full length probe
RRG 185**   F 25
RRG 445 5' atataacctaatagtgacaaataaattaac R This study
   Probe 6 (P6)
RRG185**   F 25
RRG628 5"-gcacttataaactagtccc R This study
   Probe 7 (P7)
RRG276 5"-gtgctgtttttctcacctttacac F 25
RRG629 5"-cttttgtaaggaaaatttaatata R This study
  1. 1F, forward primer; R, reverse primer
  2. * Text in capital letters refers to sequences inserted for creating restriction enzyme sites
  3. #Text in bold and italics letters refers to 7 nucleotides of coding sequence from the 3" end of p28-Omp18 gene used in the primer
  4. ** Primer sequences were presented only once when a primer was described for the first time.