Skip to main content

Table 4 Bacterial strains, plasmids, primers and oligonucleotides used in this study.

From: Fnr (EtrA) acts as a fine-tuning regulator of anaerobic metabolism in Shewanella oneidensisMR-1

Strain/plasmid/primer/Probe Relevant genotype or sequencea,b Source
Escherichia coli K-12   
   β2155 DAP auxotroph [61]
Shewanella oneidensis   
   MR-1 (ATCC 700550T) wild type [62]
   EtrA7-1 As MR-1 but ΔetrA::loxP This study
   EtrA7-1 complement EtrA7-1 complemented with the etrA gene (SO2356) cloned into This study
  pCM62  
   EtrA7-1 with pCM62 EtrA7-1 harboring the pCM62 as a negative control for complementation This study
Plasmids   
   pCM62 Tcr; traJ' trfA oriT oriV [63]
   pCM157 Tcr; trfA oriT oriV ColE1 ori; lacZp-cre [46]
   pCM184 Apr Tcr; loxP-kan-loxP [46]
   pKNOCK-Gm Gmr; oriR6K oriTRP4 [64]
   pCCG02 As pKNOCK-Gm but etrA'-loxP-kan-loxP-'etrA This study
   pCCG03 As pCM62 but lacZp-etrA This study
Primersc   
   etrAN Fwd GCCGCGGTCATGTCGGTTCTCAAGT  
   etrAN Rev CGAGCTCCGACAGCTATCTGTTAGTCT  
   etrAC Fwd CGAATTCAAATCACCGCTTTTAACTTG  
   etrAC Rev GCATATGCCAGATAAATCACACCTTTT  
   etrAScreenout AATTCTTCAGGCATTTGACTCG  
   Fwd   
   etrAScreenout GGCCGTATCTTGAGTTATACCC  
   Rev   
   etrAcomp Fwd GGATCCAGGTGTGATTTATCTGGCG  
   etrAcomp Rev GAATTCCCGACATGACAATAGAGCAGA  
   23SRT Fwd TAGCGAAATTCCTTGTCGGG  
   23SRT Rev GAGACAGCGTGGCCATCATT  
   23Stemp Rev GTATCAGTTAGCTCAACGCCTC  
   napART Fwd AGAAAGCCCTGTTAACCGTGG  
   napART Rev TCATCCGCAGCAATGGTGT  
   napAtemp Rev GATCGAAGCTACGGTTCTCG  
   nrfART Fwd GCCACATGTATGCCGTGACT  
   nrfART Rev TTTACAGCTCCAGCAAGCCA  
   nrfAtemp Rev ACGTTTCATACTCGGGATGC  
Probes   
   23SRTProbe AGTTCCGACCTGCACGAATGGCG  
   napARTProbe CTGTATTAAAGGTTACTTCCTGTCGAAAATCATGTACGG  
   nrfARTProbe CGTAATACCTTGCGTACTGGCGCGC  
  1. a The sequence for the primers is written from the 5'end to the 3'end.
  2. b Primers were designed using putative gene sequences of S. oneidensis MR-1.
  3. c For primer sequences, the restriction sites incorporated are underlined. CATATG, NdeI; GAATTC, EcoRI; GAGCTC, SacI; CCGCGG, SacII.