Skip to main content


Table 2 Validation of microarray data using qRT-PCR of randomly selected genes relative to the housekeeping gene, rpoDa

From: Analysis of the ArcA regulon in anaerobically grown Salmonella enterica sv. Typhimurium

Locusb Namec Primer sequenced Fragment (bp)e Serovar Typhimurium Gene Functionf Ratio of arcAmutant/WT Log2ratio
      qRT-PCRg Microarrayh qRT-PCRi Microarrayj
163 aerotaxis sensor receptor, senses cellular redox state or proton motive force 0.237 0.293 -2.1 -1.8
114 methyl accepting chemotaxis protein II, aspartate sensor-receptor 0.194 0.261 -2.4 -1.9
134 cytochrome o ubiquinol oxidase subunit III 4.920 5.465 2.3 2.5
155 D-amino acid dehydrogenase subunit 3.430 10.520 1.8 3.4
128 surface presentation of antigens; secretory proteins 0.855 1.010 -0.2 0.0
163 NADH dehydrogenase I chain F 0.380 1.706 -1.4 0.8
130 putative hydrolase C-terminus 0.274 0.123 -1.9 -3.0
144 tricarboxylic transport 6.440 90.770 2.7 6.5
142 putative arginine repressor 0.165 0.012 -2.6 -6.4
153 putative detox protein in ethanolamine utilization 0.181 0.159 -2.5 -2.7
118 putative regulator ethanolamine operon (AraC/XylS family) 0.189 0.188 -2.4 -2.4
137 putative carboxysome structural protein, ethanol utilization 0.197 0.105 -2.3 -3.3
126 anti-FliA (anti-sigma) factor; also known as RflB protein 0.196 0.163 -2.4 -2.6
189 LctP transporter, L-lactate permease 5.950 12.780 2.6 3.7
153 putative transcriptional regulator for lct operon (GntR family) 5.750 80.000 2.5 6.3
194 proton conductor component of motor, torque generator 0.282 0.253 -1.8 -2.0
159 nitrite reductase periplasmic cytochrome c(552) 0.314 0.285 -1.7 -1.8
  1. aSTM3211 (rpoD) is a housekeeping gene that was used as the reference gene where no significant
  2. change in expression level was observed. The primer sequences (5' to 3') used for rpoD were as follows: CGATGTCTCTGAAGAAGTGC (forward) and TTCAACCATCTCTTTCTTCG (reverse). The size of the fragment generated is 150 bp.
  3. bLocation of the open reading frame (ORF) in the S. Typhimurium LT2 genome.
  4. cRespective gene name or symbol.
  5. dFor each set, the first primer is the forward primer and the second primer is the reverse primer.
  6. eSize of the amplified PCR product.
  7. fFunctional classification according to the KEGG (Kyoto Encyclopedia of Genes and Genomes) database.
  8. gExpression levels of quantitative reverse transcriptase polymerase chain reaction - values shown as the ratio between the arcA mutant and the wild-type; where values <1 indicate that ArcA acts as an activator, and values >1 indicate ArcA acts as a repressor.
  9. hExpression levels from the microarray data - values shown as the ratio between the arcA mutant and the wild-type; where values <1 indicate that ArcA acts as an activator, and values >1 indicate ArcA acts as a repressor.
  10. iExpression levels of quantitative reverse transcriptase polymerase chain reaction comparing the arcA mutant versus the wild-type - shown in signal to log2 ratio (SLR).
  11. jExpression levels of microarray data comparing the arcA mutant versus the wild-type - shown in signal to log2 ratio (SLR).