Skip to main content

Table 2 Primers used in this study.

From: Comparative genomic analysis reveals significant enrichment of mobile genetic elements and genes encoding surface structure-proteins in hospital-associated clonal complex 2 Enterococcus faecalis

Target gene Primer sequences (5' → 3') Amplicon size (bp) Application
ef1415 F:TGTTGCGGTTTCTGCATTAG 2818 PCR on junction between EF1415 and EF1417
ef1417 R:GCATCTCGATAGACAATTCG   PCR on junction between EF1415 and EF1417
ef1489 F:GAATCGAACTAGCATTTTTGGG 465 PCR on junction between EF1489 and EF1490
ef1490 R:ATGGAACGAACCATTGGAAA   PCR on junction between EF1489 and EF1490
ef1843 F:GGAGCCGTTAGACAGACAGC 2457 PCR on junction between EF1843 and EF1847
ef1847 R:GCTTGCTTTACAGCCTCAAGA   PCR on junction between EF1843 and EF1847
ef1895 F:GCACAACAAATTTCAATTCCA 4573 PCR on junction between EF1895 and EF1898
ef1898 R:ATTGAAGTGGTTCGCTACGG   PCR on junction between EF1895 and EF1898
ef2239 F:AACTGCTGTCAAGCGTAGCA 1252 PCR on junction between EF2239 and EF2240
ef2240 R:TGTGGCATTTTGGACTGTTG   PCR on junction between EF2239 and EF2240
ef2350 F:ATAACTGAGTGATTTTCACAATTGC 654 PCR on junction between EF2350 and EF2352
ef2352 R:GATCCGTGGAAGTTCCTCAA   PCR on junction between EF2350 and EF2352
ef3216 F:TCGGCGTTGAAGACTATGAA - Sequencing of junction between EF3216 and EF3230
ef3217 F:ATTGGGAATGACGGCTACAC
R:TTGCGTATTTCGCAGCATAA
499 PCR
ef3218 F:TCGCGTAGTAGGAGCAATCA
R:TTTTGTTCAGTTCCCACACCT
396 PCR
ef3220 F:AGCTTTTGGCGAAGGAGATT
R:TTTATTGCGGGTTCCTCAGT
495 PCR
ef3221 F:TGAACGAAAATGAAGGTGGT
R:TCATCAATCTCCAACGCATC
196 PCR
ef3222 F:CAAAGAAGAATCAGCCGATTAAA
R:ATATTTGGGCATTTGCATGG
183 PCR
ef3223 F:AATTGGGAAAAAGGGGTCAG
R:TTCGTGATCTGCTTGTTGTTCT
501 PCR
ef3224 F:GTTGGGCTGGACGTATGAAT
R:TGTGGCTTTATAGGCTGTAGCA
214 PCR
ef3225 F:ATTACTTCACCGCCCATGAC
R:CGCTGGAAGTCTGCTCTTG
474 PCR
ef3226 F:GATGATTTAACCGCACAAGGA
R:TTTTTATTTCGAGCGGATGC
499 PCR
ef3227 F:ACAGGAAGCCATTCACAAACT
R:CTGATTCGTGGAAGTCCAACT
162 PCR
ef3230 R:TCCTGACTTCCGTTCTGCTT - Sequencing of junction between EF3216 and EF3230
hmpref0346_1861 F:CGAGTTAGAGGAAGCGTTGG 630 PCR
  R:CCAGACAATTTGGGCGTACT   
hmpref0346_1864 F:GAAATTTTCTGAAAGTGAAGACAAGA 299 PCR
  R:TGATTAGCAGTCACAACAGCAA   
hmpref0346_1868 F:TGTACACAAGCTACCCGGATT 538 PCR
  R:TTCCCACCTGCGTCTATTTT   
hmpref0348_0427 R:GAGACTTCAACCACTCCACAAAAACC - Sequencing of gap between contig00034-35 in TX0104
hmpref0348_0428 F:CCTGTAGAAGTATTGTCCATTTTAACGCTATC   Sequencing of gap between contig00034-35 in TX0104