Skip to main content

Table 3 Primers used in this study.

From: Exploring the contribution of efflux on the resistance to fluoroquinolones in clinical isolates of Staphylococcus aureus

Primera Sequence (5'-3') Amplicon Size (bp) Reference
QacA/B_Fw GCTGCATTTATGACAATGTTTG 628 [30]
QacA/B_Rv AATCCCACCTACTAAAGCAG   
Smr_Fw ATAAGTACTGAAGTTATTGGAAGT 285 [18]
Smr_Rv TTCCGAAAATGTTTAACGAAACTA   
NorA_Fw TTCACCAAGCCATCAAAAAG 620 [32]
NorA_Rv CTTGCCTTTCTCCAGCAATA   [13]
NorA_Fw TTCACCAAGCCATCAAAAAG 95 [32]
NorA_RT(Rv) CCATAAATCCACCAATCCC   This study
NorB_Fw AGCGCGTTGTCTATCTTTCC 213 [13]
NorB_Rv GCAGGTGGTCTTGCTGATAA   
NorC_Fw AATGGGTTCTAAGCGACCAA 216 [13]
NorC_Rv ATACCTGAAGCAACGCCAAC   
MepA_Fw ATGTTGCTGCTGCTCTGTTC 718 [13]
MepA_Rv TCAACTGTCAAACGATCACG   
MepA_RT(Fw) TGCTGCTGCTCTGTTCTTTA 198 [13]
MepA_RT(Rv) GCGAAGTTTCCATAATGTGC   
MdeA_Fw AACGCGATACCAACCATTC 677 [13]
MdeA_Rv TTAGCACCAGCTATTGGACCT   
MdeA_RT(Fw) GTTTATGCGATTCGAATGGTTGGT 155 [33]
MdeA_RT(Rv) AATTAATGCAGCTGTTCCGATAGA   
16S_27f AGAGTTTGATCMTGGCTCAG 492 [34]
16S_519r GWATTACCGCGGCKGCTG   
GrlA_Fw TGCCAGATGTTCGTGATGGT 339 [35]
GrlA_Rv TGGAATGAAAGAAACTGTCTC   
GyrA_Fw TCGTGCATTGCCAGATGTTCG 394 [35]
GyrA_Rv TCGAGCAGGTAAGACTGACGG   
  1. aThe primers used in the RT-qPCR experiments are indicated by the RT label. Fw: forward; Rv: reverse. For norB, norC and smr, the same set of primers was used for both PCR and RT-qPCR, as well as the primer NorA_Fw.