Skip to main content

Table 2 Synthetic oligonucleotides

From: Characterization of a Mycobacterium smegmatis uvrAmutant impaired in dormancy induced by hypoxia and low carbon concentration

Name Sequence (5' - 3')a Position of annealing b
uvrA-Ms-Y ctag tctaga gacgtgtccggtgtaggtgt -180/-160
uvrA-Ms-R ctag tctaga atgacctggtggatcgactg +150/+169
uvrA-Tb-F ctag tctaga cgatgccttgaggatcgtg -258/-240
uvrA-Tb-R ctag tctaga gaagatcgaaacccgatacg +194/+213
  1. a Underlined is an unpaired tail carrying Xbal restriction site. b Position of annealing refers to the uvrA gene sequence, with the first base of the translational initiation codon as +1.