Skip to main content

Advertisement

Table 2 Primers used for PCR and qPCR

From: The rgg 0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilusLMG18311 thermal adaptation

Name Primer sequence (5'-3')
Primers for vectors construction
Rgg0182I1 CTGGAACTGCAGGAGCAGC
Rgg0182I2 ATAATTTGAGAATTCTGTACCTT
Rgg0182II1 TCTCTGGAATTCTTTAAATTG C
Rgg0182II2 CTTGTCCTGCAG TCTCACTCCC
Rgg0182SE1 CCCCCCCCATATGGGAAAACAAAATGAACTG
Rgg0182SE2 CCCCGGATCCTTAACCTACAATCGACTTAAA
Pep0182up GAAGAATTCGTAAAAAGCATCAGATTTTAC
Pep0182down AACTACTAGTGCATTTTAAGTCGATTGTAGG
SHP0182up GAAGAATTCAACAATTTCATATGATTTCCTCC
SHP0182down AACTACTAGTTCAGTCTCTCCTCTTTC
Primers for DNA EMSA
Pldh-5' ACGCTTTCACTTAATAATTC
Pldh-3' TGGTCTAAACATCTCCTTA
Pshp-5' GTAAATACATGTCAATAGGAC
Pshp-3' TTTGTTTTCCCATATATGCAACC
Ppep-5' AGCATCAGATTTTACTCCAGATG
Ppep-3' TTGTAGGTTAATCCCGTTTATGC
Primers for gene expression analysis
Gene Locus Forward Reverse
ldh stu1280 AAGCTATCCTTGACGATGAA AATAGCAGGTTGACCGATAA
rgg 0182 stu0182 GAAGTGGAGGAGTTGCCTAA CCCAGCTCTCAATCCCAAA
hrcA stu0118 ACACCTCTTCAAGGAACTGAT GTCACTTCATCATCGGAGATA
dnaK stu0120 GACATTGACGAAGTCATCCT GCACCCATAGCAACTACTTC
dnaJ stu0121 CGTGAAGTGACATGTAAGACA ACCAAGTGGTGTTTGTGTATC
groES stu0203 GAAGGTACCCGTACTCTTACTG AACGTAATCTTCTCCGTCTTTA
groEL stu0204 ATTGCTTATAATGCCGGTTA AGCGTTAAATCCTGTACCAA
hsp33 stu0180 TTTAGTAGGTCCTTTCATG CGATTTCACCAGAAATAAGC
cspA stu0837 ATTGGTTTAACGCTGACAAAG TAACCTTTTGACCTTCATCGT
cspB stu0838 TATGGCAAATGGAACAGTAAA CAAGTGATTTGAATCCATCAG
ctsR stu0076 AGATCAGCTCAGCGAACA AGAATACGCGAACGAATG
clpC stu0077 ACTGGCAGATTATACCAAAGAC CACCTACCAAGACAGGATTATT
clpP stu0356 CTTGCTCAAGACTCGTAATAACT AAGCCATATTCAAGTGTTTCTT
clpX stu0581 TGGACTTATCCCTGAATTTATC AAGACAAGAGGGTTTGATACTG
clpE stu0602 CCGTACCAAGAACAATCCT ACGGATAACTTGCTTGCTT
clpL stu1614 CGTTTCGACGCAGTTATT TTCGCTAACTGCCAAGTC
  1. Restriction sites are indicated with bold letters: PstI: CTGCAG; EcoRI: GAATTC; SpeI: ACTAGT; NdeI: CATATG; BamHI: GGATCC