Skip to main content

Table 4 Primers developed in this study for the specific identification of C.jejuni and C. coli.

From: A simplified and cost-effective enrichment protocol for the isolation of Campylobacter spp. from retail broiler meat without microaerobic incubation

Target Gene Primer Name Sequence (5'-3') Tm (°C) G+C Content (%) Product Size (bp)
glyA F-JK TGGCGGACATTTAACTCATGGTGC 59.6 50 264
  R-JK CCTGCCACAACAAGACCTGCAATA 59.5 50  
ask F-JK GGCTCCTTTAATGGCCGCAAGATT 59.8 50 306
  R-JK AGACTATCGTCGCGTGATTTAGCG 58.5 50