Skip to main content

Table 2 Oligonucleotide primers

From: Role of the SaeRS two-component regulatory system in Staphylococcus epidermidisautolysis and biofilm formation

Target gene GenBank accession no. Primer* Primer sequence Location
Oligonucleotide primers used for RT real-time PCR
gyrB 57636585 gyrB-F CTTATATGAGAATCCATCTGTAGG 1110-1263
   gyrB-R AGAACAATCTGCCAATTTACC  
lrgA 57636056 lrgA-F TGGACTTGTACTATTATTTATCGC 165-309
   lrgA-R AAGGATTGGTAAAGAGTTAATGAC  
lytS 57636054 lytS-F CTGTTCAAGATAATGGTCAAGG 1535-1680
   lytS-R CAGTGCCGATGTTGTTCC  
serp0043 57636640 serp0043-F CAAGCACAAGCGTCTTCATC 73-236
   serp0043-R ACTCTTTCACCATTATTTGTTTCAG  
glpQ 57637130 glpQ-F CCGTTACACTGGGTTTAGC 41-221
   glpQ-R TTACCACTTACTGAGTCTGATTC  
arlR 57636010 arlR-F AGAGAATGATGGAAAGGCAGGT 90-253
   arlR-R ATGTCTCGCTTTTCGCAGTAAT  
atlE 57637180 atlE-F AACAACCACAGAATCAGTCTAATC 92-237
   atlE-R TTGAACTTGGGTAGGGTCTTG  
aae 57637180 aae-F AACAAATTGATAAAGCAACG 1970-2186
   aae-R GTTGTCTTTCCTTTAGTGTC  
aap 57636451 aap-F AATAGAACCTACAACTTCAGAACC 945-1039
   aap-R TGTTATTGGATGAACTATCAGCAG  
icaA 57636387 icaA-F GGTTGTATCAAGCGAAGTC 556-754
   icaA-R ACATCCAGCATAGAGCAC  
saeS 57636974 saeS-F GGTATCGTTCCAGAACTTCAATC 757-881
   saeS-R ATTTGTTGTGCTAACTCATTTGC  
saeR 57636975 saeR-F CTCAAGAACATGACACGATATACG 245-354
   saeR-R TCTAGCGAGAAGGTTATTAGTACG  
saeQ 57636990 saeQ-F GCAAGTTTCTTTGGAGCCTTC 268-447
   saeQ-R CTTATCTTCACCTCGGTTATTACG  
saeP 57636991 saeP-F CTAACTCGGAAAGCGATCAC 71-258
   saeP-R GTCTGGACCTTTAGAAGATTTG  
Oligonucleotide primers used for eDNA quantification
gyrA 57636584 gyrA-F CCTTATGAAACTCGGAGATGG 2382-2489
   gyrA-R TCAGTAGTAGTAGATTGTTGCG  
lysA 57637514 lysA-F TGACAATGGGAGGTACAAGC 32-107
   lysA-R TGGTCTTCATCGTAAACAATCG  
serp0306 57636873 serp0306-F ATGCCACATCCACGAAAGA 203-381
   serp0306-R TGTAACTGACAATGCCCAATC  
leuA 57638228 leuA-F GTGAACGGTATTGGTGAAAGAG 685-762
   leuA-R GTGGTCCTTCCTTACATATAAAGC  
  1. F, forward primer; R, reverse primer