Skip to main content

Table 2 Primers utilized in this work

From: Tools for genetic manipulation of the plant growth-promoting bacterium Azospirillum amazonense

Primers Sequence Annealing temperature Amplicon length (bp) Purpose
glnB_sfint CGCCGCGATACAGCTCGGTATG 57°C 2108 glnB region isolation
revsf_glnBint GATGGACGATCAGTTGGTCGA 57°C 2108 glnB region isolation
glnA_aa_do ACGGTCGGCACTTCCTTCAG 53°C 1621 glnB region isolation
pglnB_up_BamHI CGGGATCCTCGTCGAAGCTGAAGGTCAT 55°C 727 glnB promoter amplification
pglnB_do_NcoI GATCTTTTCCATGGCTTACGGC 55°C 727 glnB promoter amplification
pglnK_up_BamHI CGGGATCCTTGTCCAGTGCCACGCTCAT 55°C 328 glnK promoter amplification
pglnK_do_NcoI CACGAGCTCCATGGGTAGTCC 55°C 328 glnK promoter amplification
Kglndel_A _EcoRI ATGAATTCCAATGCACAGGGTGCGTA 55°C 574 (AB) and 1111 (AD) glnK mutagenesis
Kglndel_B CCCATCCACTAAACTTAAACACGCCACCACGAGCTTCAT 55°C 574 glnK mutagenesis
Kglndel_C TGTTTAAGTTTAGTGGATGGGATGACCATCGCCGACGCG 55°C 558 glnK mutagenesis
Kglndel_D_BamHI CGGGATCCCGATGGTGGGCGGATATTTG 55°C 558 (CD) and 1111 (AD) glnK mutagenesis
glnK_NdeI_up GGACTACATATGAAGCTCGTGGTG 60°C 361 (wt) or 121 (mut) glnK mutagenesis verification
glnK_BamHI_do CGTCACGGGATCCTCATAAGGC 60°C 361 (wt) or 121 (mut) glnK mutagenesis verification
conf_glnK_up GCCCCCTCCAGGATCTTC 55°C 1522 (wt) or 1282 (mut) glnK mutagenesis verification
conf_glnK_do GGGTAAAATGCCCTTGTCCA 55°C 1522 (wt) or 1282 (mut) glnK mutagenesis verification
  1. Underline - restriction sites; Bold - sequence tag; wt - wild-type; mut - mutant; AB - amplification using the primers KglndelA_EcoRI and KglndelB; AD - amplification using the primers Kglndel_A_EcoRI and Kglndel_D_BamHI; CD - amplification using the primers KglndelC and Kglndel_D_BamHI