Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: The MP65 gene is required for cell wall integrity, adherence to epithelial cells and biofilm formation in Candida albicans

Gene name Oligonucleotide 5' to 3' sequence Localization
    from/to orf
MP65 MP65f TGTTGTTGTCACTATTGGTAATGG 126-149 19.1779
  MP65r CGGCAGCAGAAGAAGAAGC 318-300  
DDR48 DDR48f AACAACGACGACTCTTATGG 85-104 19.4082
  DDR48r TGGAGGAACCGTAGGAATC 214-196  
PHR1 PHR1f GTGTTGAACCAGTATTACCTTGAC 1321-1344 19.3829
  PHR1r GGAAGATGCCTTACCAGTAGC 1461-1441  
STP4 STP4f CCACATTATGAGCAAGAGTATAG 217-239 19.909
  STP4r TACACAGACGAGGAAGCC 353-336  
CHT2 CHT2f GCTACTACACAATCTACCACTAC 940-962 19.3895
  CHT2r TTGAAGAAGAGGAGGAGGAAG 1096-1076  
SOD5 SOD5f TTACAATGGAACCGTTAG 288-305 19.2060
  SOD5r TAGGAGTCGTCATATTCA 401-384  
ACT1 ACT1f CGATAACGGTTCTGGTATG 691-709 19.5007
  ACT1r CCTTGATGTCTTGGTCTAC 786-768