Skip to main content

Table 4 Genomic islands in the four Japanese H. pylori strains

From: Evolution in an oncogenic bacterial species with extreme genome plasticity: Helicobacter pyloriEast Asian genomes

Strain GI number Type Length Start-end Flanking repeat (bp) Secretion system Left gene (annotation) Right gene (annotation)
F16 GI_HP_F16_1 prophage-like 12245 471964 - 484208 (HPF16_0465 - HPF16_0478) N/D(a) N/D(a) HPF16_0464 (IS605 transposase (tnpB)) HPF16_0479 (typeIIR)
  GI_HP_F16_2 cagPAI 36761 871413 - 834651 (HPF16_0834 - HPF16_0810) 22(b) Type IV HPF16_0835 (hypothetical protein) HPF16_0809 (glutamate racemase)
F30 GI_HP_F30_1 (left) type 1b TnPZ partial 7246 1280406 - 1287651 (HPF30_1205 - HPF30_1211) N/D(a) tfs3b partial HPF30_1204 (outer membrane protein horB) HPF30_1212 (rpoD)
  GI_HP_F30_1 (right) type 1b TnPZ partial 1655 1237267 - 1238921 (HPF30_1166 - HPF30_1167) N/D(a) N/D(a) HPF30_1165 (hypothetical protein) HPF30_1168 (5'-methylthioadenosine/S -adenosylhomocysteine nucleosidase)
  GI_HP_F30_2 cagPAI 37153 867993 - 830839 (HPF30_0803 - HPF30_0778) 22(c) Type IV HPF30_0804 (hypothetical protein) HPF30_0777 (glutamate racemase)
F32 GI_HP_F32_1 type 2 TnPZ partial 24283 1058236 - 1082518 (HPF32_0988 - HPF32_1014) N/D(a) tfs3 partial HPF32_0987 (hypothetical protein) HPF32_1015 (hypothetical protein)
  GI_HP_F32_2 cagPAI 36609 534488 - 571096 (HPF32_0500 - HPF32_0524) 44(d) Type IV HPF32_0499 (hypothetical protein) HPF32_0525 (glutamate racemase)
F57 GI_HP_F57_1 (left) type 1b TnPZ partial 7246 103791 - 111036 (HPF57_0102 - HPF57_0109) N/D(a) tfs3b partial HPF57_0101 (RNA polymerase sigma factor RpoD) HPF57_0110 (hypothetical protein)
  GI_HP_F57_1 (right) type 1b TnPZ partial 1625 152699 - 154323 (HPF57_0147 - HPF57_0148) N/D(a) N/D(a) HPF57_0146 (5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase) HPF57_0149 (hypothetical protein)
  GI_HP_F57_2 type 1 TnPZ 38991 284353 - 323343 (HPF57_0279 - HPF57_0311) 8(e) tfs3b partial HPF57_0278 (typeIIM) HPF57_0312 (type II DNA modification enzyme )
  GI_HP_F57_3 cagPAI 36797 562215 - 599011 (HPF57_0550 - HPF57_0575) 22(c) Type IV HPF57_0549 (hypothetical protein) HPF57_0576 (glutamate racemase)
  1. a) N/D, not detected
  2. b) TTATAATTTGAGCCATTATTTA
  3. c) TTTCAATTTGAGCCATTCTTTA
  4. d) TTATAATTTGAGCCATTCTTTAGCTTGTTTTTCTAGCCAAACCA
  5. e) ACATTCTT