Skip to main content

Table 3 Primers used in this study.

From: Characterization of mleR, a positive regulator of malolactic fermentation and part of the acid tolerance response in Streptococcus mutans

Primera Sequence (5'→3') Purpose
135UpF CCAAATAACCCGCATATTGAGG Knockout mleR
135UpR GGCGCGCC TTGAAATTTTTCAGCAACCTTA Knockout mleR
135DoF GGCCGGCC TCCTCAACCTTAACACCTGATA Knockout mleR
135DoR GTTGCTAAAGATTTGTTCTCAG Knockout mleR
ErmF GGCGCGCC CCGGGCCCAAAATTTGTTTGAT ErmEA
ErmR GGCCGGCC AGTCGGCAGCGACTCATAGAAT ErmEA
lucF ATATACCATGG AAGACGCCAAAAAC Luciferase
lucR AAAAAAACTAGT TTATGCTAGTTATTGCTCAGCGG Luciferase
P135F/EP9 AAAAAACCATGG CTTTATTCAAAAAAGGATCGTTT Promoter mleR/EMSA
P135R TTTTTTCCATGG TTAACCTTTCTATTATTTTTACTAGTT Promoter mleR
P137F/EP6 AAATTTCCATGG CAAGACTGTTAAAGTCAAAAA Promoter mleS/EMSA
P137R/ AAAAAACCATGG TTTCTGCACCTCCTTATATT Promoter mleS
135qF TGAAGCGTCACCTTGAGAGA Smu.135 QPCR
135qR TAATGGGTGGGCATCCTAAG Smu.135 QPCR
136qF AAGGTATCATCGGCAAGCAC Smu.136 QPCR
136qR TCACTTTTTCAAGCGTCTGC Smu.136 QPCR
137qF GGTATCTTTGCGGCTATGGA Smu.137 QPCR
137qR TTTCACGCAAGACACGAGAG Smu.137 QPCR
138qF CGACGGATAGCAAGTCTGGT Smu.138 QPCR
138qR GTCAACGTGCTAGTCGCAAA Smu.138 QPCR
139qF TACAGCGATTGACGAGAACG Smu.139 QPCR
139qR AGAAATTGGCTTCGCTGAAA Smu.139 QPCR
140qF TTCCTATGCGGATTTTCAGG Smu.140 QPCR
140qR CCTGACCGATTTGGGAATA Smu.140 QPCR
1114qF TACTACCCGGCCCCGATT Smu.1114 QPCR
1114qR CGAGCACGCAAAACAATAGA Smu.1114 QPCR
EP1 TTAACCTTTCTATTATTTTTACTAGTT EMSA
EP2 TCCAAGTGGTTTAAAAGTAACAAGA EMSA
EP3 GCAACTTCCCAAGAGAAAACA EMSA
EP4 TTAATCAAGATTATCAATAATCTC EMSA
EP5 ATGAAGAAAAAAAGCTATCT EMSA
EP7 TGCTTGCCGATGATAGGTT EMSA
EP8 TAAAGAATACAAGTTTAAAAGCAAATAGTTAACT EMSA
EP10 ATAAGTATTTTTTATCCGTTATCTAAGGTTTGAC EMSA
EP11 GTCAAACCTTAGATAACGGATAAAAAATACTTAT EMSA
  1. a Restriction sites in bold