Skip to main content

Table 3 Characteristics of VNTR markers for fingerprinting of Aspergillus fumigatus

From: Multiple-locus variable-number tandem repeat analysis for molecular typing of Aspergillus fumigatus

VNTR markers Primer sequences (5' to 3') Tm (°C) Unit repeat size (bp) Range of
repeat number
Simpson diversity index* Marker location (non coding region or name of gene if coding)
Asp 167 TGAGATGGTTAACTTACGTAGCGC
CGCTCCCACCGTTACCAAC
59 12 4-8 0.7151 Chromosome 1 (GPI anchored serine-rich protein)
Asp 202 AGGATCACTGCCCTCAACCC CCGAAATCCGCGGGA 59 12 6-14 0.8530 Chromosome 1 (c-24(28) sterol reductase)
Asp 330 ATCTGGTCGCGAAATTCCTCT
TCTTCGGCCTTTTCATCCC
58 11 2-8 0.7895 Chromosome 1 (non coding)
Asp 443 AAGCTTCGTCTGGCGAAGAG
GCACGTGTACGGTGTTCCTG
58 18 0-7 0.6661 Chromosome 1 (ribosome assembly protein Noc2)
Asp 446 CGATCATGTTTGCCTGAGGA
CCGACAGCATCGAGCAACTA
59 21 1-4 0.5971 Chromosome 1 (non coding)
Asp 165 TGATGGGCCGCAGTCG
GCACCTGCTTGTCGATTCGT
60 10 0-6 0.7296 Chromosome 5 (non coding)
Asp 252 CAGATTGGAGACACGAAGCG
ACCACGGATTGCCAAGGA
58 12 2-6 0.5886 Chromosome 5 (non coding)
Asp 345 TCTCCAACCCTTCGGACG
GCCGGAAGAGCATGAAGACA
58 11 1-6 0.5771 Chromosome 5 (non coding)
Asp 204 GATGCGGGAGGTGGGTC
CGTCCTCACTTTTGCCTTGG
58 11 1-5 0.6128 Chromosome 6 (non coding)
Asp 20 GGGAAGAGAGGAACCGATCC
CGCAGTGGGCAGTTTGAAT
58 10 0-4 0.7520 Chromosome 8 (non coding)
  1. *Each index was calculated with the results from 57 unrelated A. fumigatus isolates