Skip to main content

Table 3 Potential regulatory elements and intergenic motifs of the JG024 genome.

From: Characterization of JG024, a pseudomonas aeruginosa PB1-like broad host range phage under simulated infection conditions

Position ORF Sequence Orientation Score dG (kcal mol-1)
putative σ 70-dependent promoter elements:
9286..9336 ORF18 ATGTTTGAATCTCTTTTGAA CGT TTGATGTTTCCCCTATAA TAAGC GCACA Forward 1.22  
13050..13100 ORF22 TCATCTATAAGTAACGTTAT AAC ATAACGTCAATTTATATGCT CTA GACGT forward 1.19  
putative rho-independent terminator elements:
2313..2343 ORF 10 AAGCCCGGA GCGATCCGGGCTT T TCTGTGTT reverse   -17.5
16623..16644 ORF24 GGCCGG GTTTCCGGCCTT TGTT forward   -12.3
35910..35942 ORF48 AAAAGGCCGCT TATTCAGCGGCC TTTT TGCTTT forward   -18.3
35931..35900 ORF49 AAAAGGCCGCT GAATAAGCGGCC TTTT CTTTT reverse   -18.3
59033..59059 ORF77 AGGCCGCC TTCGGGCGGTCT TTT CTTT forward   -14.7
60667..60706 ORF80 AAAGCCCCGG ACTCT AGTTCAGA A TCCGGGGCTTT CTTTT forward   -23.8
60700..60657 ORF81 AAAGCCCCGG ATTCT GAACTAGA G TCCGGGGCTTT GTCGCTTCT reverse   -23.8
  1. Position and orientation of putative sigma 70 promoters and putative rho-independent terminator regions. The putative promoters were identified using SAK and Virtual Footprint as described in Methods. "Orf" indicates the Orf in the 3'-region of the putative promoter. Bold letters of the promoter sequences indicate -35 and -10 regions. The putative terminator regions were identified using the programs TransTerm and FindTerm as described in Methods. The indicated Orf is the respective Orf in the 5'-region of the putative rho-independent terminator.