Skip to main content

Advertisement

Table 2 List of primers used in this study

From: The role of glyceraldehyde 3-phosphate dehydrogenase (GapA-1) in Neisseria meningitidis adherence to human cells

Primer DNA sequence* Restriction site
Expression   
   NMB0207(F) CGCGGATCC ATGGGCATCAAAGTCGCCATC Bam HI
   NMB0207(R) CGCGTCGAC TTATTTGAGCGGGCGCACTTC Sal I
Mutagenesis   
   NMB0207(R)FL GAGAACTGTCATGCGTATTCC  
   NMB0207(F)FL CCAAACCCAATGCCGCGAATG  
   gapA1_M1(IR) GCGAGATCT GCAACAAACCGTC Bgl II
   gapA1_M2(IF) GCGAGATCT GGTTTGTTCCTTTGTTGAGGG Bgl II
Complementation   
   pSAT-12iPCR(IF) CGCAGATCT GATACCCCCGATGAC Bgl II
   pSAT-12iPCR(IR) CGCAGATCT CATTTGTGTC TCCTTGG Bgl II
   gapA1_Comp(F)2 CGCGGATCC ATGGGCATCAAAGTC Bam HI
   gapA1_Comp(R)2 CGCGGATCC TTTGTTTGACGGTTTGTTG Bam HI
  1. *All primers were designed from the N. meningitidis MC58 genome sequence. Sequences in bold identify restriction enzyme sites.