Skip to main content

Table 3 Primers used in this study

From: Genetic analysis of the capsule polysaccharide (K antigen) and exopolysaccharide genes in pandemic Vibrio parahaemolyticus O3:K6

Target Location Primer sequence
Cm cassette pKD3 forward 1 GTGTAGGCTGGAGCTGCTTC
  pKD3 reverse 1 CATATGAATATCCTCCTTA
  pKD3 forward 2 ACCTGTGACGGAAGATCACTTCG
  pKD3 reverse 2 AGGAACTTCATTTAAATGGCGCG
flanking sequence of VP0220 (wbfF) gene upstream forward* CCCAGCCATAACTAACACTAACCCGT
  upstream reverse GAAGCAGCTCCAGCCTACACGATAATTCGCTATTTAAATCGAGAGTTAAA
  downstream forward TAAGGAGGATATTCATATGGGAACGACAAGATCATTCCAATCAG
  downstream reverse* TAGGCTAAGTTCTGAGAGGTTTCCG
flanking sequence of CPS region VP0219-0237 upstream forward AATACTAGTGAGCTGTGTTCTTCATTATTAATCCT
  upstream reverse CGAAGTGATCTTCCGTCACAGGTGCAGTGAATGTCTGTTAACTCT
  downstream forward CGCGCCATTTAAATGAAGTTCCTCAGGCTCGTTACCAATGTGCT
  downstream reverse GCCAATTATCCTAGACTCACCACT
flanking sequence of VP0215-0218 upstream forward CACCAGCATTGATCTGGTTATTCA
  upstream reverse CGCGCCATTTAAATGAAGTTCCTTATTTAAGGGAGCTTCGGCTCCCT
  downstream forward CGAAGTGATCTTCCGTCACAGGTAGAGCTGTGTTCTTCATTATTAATCC
  downstream reverse TCGGCATTAGAGTAGCTCACTAACG
flanking sequence of EPS genes VPA1403-1406 upstream forward $ CCACTACCCACAGAACCGCTTTGT
  upstream reverse CGAAGTGATCTTCCGTCACAGGTATGACCTAGTTTCCCTTCTAGCA
  downstream forward CGCGCCATTTAAATGAAGTTCCTAGCCAGGTTTAACCAACATATTGA
  downstream reverse$ ACCACTCCAAAGGGTAGTGGTGA
flanking sequence of wza, wzb, wzc genes upstream forward CAGGGAATCAAGCATACGTTGAA
  upstream reverse CGAAGTGATCTTCCGTCACAGGTATTCATCTGACGTAAAGAGCGA
  downstream forward CGCGCCATTTAAATGAAGTTCCTATCTAGATCGCTAATTTGACCAAA
  downstream reverse GAGCAGCAAAGCTGCAGATTGA
  1. *Primers to amplify DNA for ∆0220 complementation.
  2. $Primers to amplify DNA for ∆EPS complementation.