Skip to main content

Table 1 Bacterial strains, plasmids and PCR primers used in this study

From: The role of sigma factor RpoH1 in the pH stress response of Sinorhizobium meliloti

  Characteristics Reference
Sinorhizobium meliloti   
Rm 1021 Spontaneous mutant of wild type strain RU47, Smr [64]
Rm 1021ΔrpoE1 Rm1021 derivative, rpoE1 mutant This study
Rm 1021ΔrpoE2 Rm1021 derivative, rpoE2 mutant This study
Rm 1021ΔrpoE5 Rm1021 derivative, rpoE5 mutant This study
Rm 1021ΔrpoH1 Rm1021 derivative, rpoH1 mutant This study
Rm 1021ΔfecI Rm1021 derivative, fecI mutant This study
Escherichia coli   
DH5_MCR F- endA1 supE44 thi-1 λ- recA1 gyrA96 relA1 deoR Δ(lacZYA-argF)U169 ϕ80dlacZ ΔM15 mcrA Δ(mrr hsdRMS mcrBC) [65]
S17-1 E. coli 294::[RP4-2(Tc::Mu)(Km::Tn7)] pro res ΔrecA Tpr [55]
Plasmids   
pK18mobsacB pUC18 derivative, sacB lacZ α Kmr, mobilizable [58]
pJrpoH1 pJN105 derivative, rpoH1, Gmr This study
Primers   
DEL_rpoE1_A AGTAGGATCCGCGATCAGGAGGTCAT This study
DEL_rpoE1_B GTCCTTCATCGCTTCGGCAACCGGCATCAATTCCAG This study
DEL_rpoE1_C CTGGAATTGATGCCGGTTGCCGAAGCGATGAAGGAC This study
DEL_rpoE1_D AGTCGGATCCACGATCCTCTGCGTTGAAGC This study
DEL_rpoE2_A ATCGGAATTCGCTCGTCCTCGATGAT This study
DEL_rpoE2_B AACGAAGGCACGCGAGGTGACACGCTTGAACTCTTGG This study
DEL_rpoE2_C CCAAGAGTTCAAGCGTGTCACCTCGCGTGCCTTCGTT This study
DEL_rpoE2_D AGCGGAATTCAACCGCGACGGTTCCTATC This study
DEL_rpoE5_A GCGCAAGCTTCTGCAGGATGGAAGCGATT This study
DEL_rpoE5_B CTCGTCCGCTCAGTTCAATTGTCGCGATGCGTGACC This study
DEL_rpoE5_C GGTCACGCATCGCGACAATTGAACTGAGCGGACGAG This study
DEL_rpoE5_D ACGTAAGCTTGCCGACCAGAACCGTAA This study
DEL_rpoH1_A CGAAGACAGCGACGATGCAC This study
DEL_rpoH1_B ACCAGCCAATCCTGCCACTGCTCGAACTTCTTGACCGCCT This study
DEL_rpoH1_C AGGCGGTCAAGAAGTTCGAGCAGTGGCAGGATTGGCTGGT This study
DEL_rpoH1_D TATGAAGAGAGGCTCGGCCA This study
DEL_fecI1_A CGCGCATTGGTCGTGCGATT This study
DEL_fecI1_B GGTGCCGCAGGTACATGTGA This study
DEL_fecI1_C TCACATGTACCTGCGGCACCAGGCCTCGACCATGACGAAT This study
DEL_fecI1_D GATCGTGCGCCACATCGAAG This study