Skip to main content

Table 4 Oligonucleotide primers used in this study.

From: The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

Primer Sequence Commenta
Bfp1_F CAGCAGCATATGGACGAAGAAATCATTATTTTGATTAAT E, L
Bfp1_R CAGCAGGGATCCTTACCACAAAATTTCAGTTCCC E, L
Bfp2_F CAGCAGCATATGACAAGAAGAGTTGATTCTGCCAG E
Bfp2_R CAGCAGGGATCCTTATTTATTAGGTGACACTTTAAT E
Bfp3_F CAGCAGGGATCCAGAAGATAATGTAATTGCTTCTTT E
Bfp3_R CAGCCAGGAATTCTCATCGGTGTATATTGGTTATC E
Bfp4_F CAGCAGGGATCCGAAGACAATTTAGAATCTTTAA E, L
Bfp4_R CAGCAGGGATCCTCATCGCGATATAATAGAATATTC E
Bfi1A_F CAGCAGGAATTCGAGGATGTAATGGCTATTATG E, L
Bfi1A_R CAGCAGGGATCCTTACCTTCCAATATAAATGTC E
Bfi1B_F CAGCAGGGATCCACACCAACCAGATACTCCACC E
Bfi1B_R CAGCAGGAATTCTTACTCTTTTTTTTCGGCTGTG E, L
Bfi4_F CAGCAGGAATTCAGGGATGGAGATTGGGATTC E
Bfi4_R CAGCAGGGATCCTTAATTATCCTTTCCCTTTTGTTT E, L
Bfgi2_Int_F CCTGATATTAGCTTCTCTATCTTTTTTGCC I
Bfgi2_Int_R CAGCAGGGATTCCGAAGATAATGTAATTGCTTC I
Bfgi2_attB_F CCGGGAATGTTTCGTCAGGAATTGATGGTG I
Bfgi2_attB_R GGTTTATTGATTGTTATTTGTCGGCAAAG I
  1. a Primer used in E = Expression studies, L = Linkage studies, I = Integration/Excision studies