Skip to main content

Table 1 Oligonucleotides

From: Brucella abortus ure2 region contains an acid-activated urea transporter and a nickel transport system

RT PCR   Gene set
RT_BAB1_1374_Bam HI.F GGATCC ACACGCGATTTCCTTTCATC 1
RT_ureA2 _Bam HI.R GGATCC CATCACCTCTTCGACGGTTT 1, 2
RT_BAB1_1375.F AAGGTCCTGCCAGTACAACG 2
RT_ureA 2.F AAACCGTCGAAGAGGTGATG 3
RT_ureC 2.R CGCAGATCCTTCTCGATTTC 3
RT_ureC 2.F ACAGTCGATCTCGCTCAACC 4
RT_BAB1_1381.R CTTGATAAGGATTGGCACGA 4
RT_BAB1_1381.F ACCTGATCCGTGAAAACGTC 5
RT_BAB1_1383.R GAAAGAACAGTCCCGTCAGC 5
RT_BAB1_1383.F GGATACAACCAAGCCTGCAT 6
RT_BAB1_1386.R GGCATTGCGGATGATAAGTT 6
RT_BAB1_1386.F GCTTTTTCTCTGGGCCAAAT 7
RT_BAB1_1388.R GACAGGGAAAGCTTGTCGAG 7
ΔureT   
U_BMEI0642_Xba I.F TCTAGA GACCCAGACCATAACGCTTG  
U_BMEI0642_Bam HI.R GGATCC CTGCCATGGAGGCCTCCT  
BMEI0642.F AGGAGGCCTCCATGGCAGGGATCC CCTGAGCCTGATTTCTGGA  
D_BMEI0642_Pst I.R CTGCAG GACCGATCCGTCATTGACAT  
aphT   
aphT.F ATACTGCAG ATTAGAAAAACTCATCG  
aphT.R TCACACAGGAAACAGCTATG  
ΔnikO   
BAB1_1388 XbaI.R ACGTTCTAGA CAATATCTGCGTGCTCTCCA  
RT_BAB1_1388.R GACAGGGAAAGCTTGTCGAG  
BAB1_1388 Bgl II.F CTCGACAAGCTTTCCCTGTCAGATCT CCACCTGCATTATGTCGAG  
BAB1_1388 Pst I.R ACGTCTGCAG CATTATCGATAGCGGCCTTG