Skip to main content

Table 4 Oligonucleotide sequences used in this study.

From: The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori

Primer Sequence (5'-3') Gene Comments
flgE-F GGCTAACGAGCGTGGATAAG flgE FP of flgE
flgE-R GAGCGAGCGCTAAAGTCCTA flgE RP of flgE
era-F AAGGCTAATGCGACCAGAAA hp0517 FP of era
era-R GGAGCCCTGGTGTGTCTAAA hp0517 RP of era
ML022FP CGGGATCCCGGGGCGAAAGATTGGAGATTT hp0256 Allelic exchange mutagenesis
ML027RP CCATCGTAGATCTGGGCTGC AGCGAATTTTTTCATAGAAAAATCG hp0256 Allelic exchange mutagenesis
ML028FP GCAGCCCAGATCTACGATGGGCAATTAAAAAGCGCTCTAAGAAT hp0256 Allelic exchange mutagenesis
ML023RP CGGAATTCCGTTACGCATGCAAGCCCTC hp0256 Allelic exchange mutagenesis
HP0256-F2 TATAACAAGGAGTTACAACAATGAAAAAATTCGCTTCTGTG hp0256 FP of hp0256
HP0256-R GCGCGCATCGATTTACGCATGCAAGCCCTCTT hp0256 RP of hp0256
FLA-F2 GCGCGCGGATCCCATGCTCCTTTAAATTTTGC flaA FP of flaA promoter
FLA-R TGTTGTAACTCCTTGTTATA flaA RP of flaA promoter
minD-F TAATTTAGCGATCGGCTTGG minD FP of minD
minF-R TCCATCACATCCACCACATC minD RP of minD
hp0610-F ATAACGGCGTTCATTCTTGG hp0610 FP of hp0610
hp0610-R GCGGTTGTTATGCAAGGTTT hp0610 RP of hp0610
omp6-F GCCCGATTCTAAAGGGTTTC omp6 FP of omp6
omp6-R GGCCAAACTCTTTGGTGGTA omp6 RP of omp6
hpn-F ATGGCACACCATGAAGAACA hpn FP of hpn
hpn-R GATGAGAGCTGTGGTGGTGA hpn RP of hpn
HP0256-QF GCGCGCCCATGG AAAAATTCGCTTCTGTATTGG hp0256 FP of hp0256
HP0256-QR GCGCGCGGATCC TTACGCATGCAAGCCCTCTTT hp0256 RP of hp0256
  1. FP, forward primer; RP, reverse primer.