Table 1 Description and specificity of oligonucleotide probes
Probe | Target sequence (5' to 3')a | Label | Positionb | Target bacteriac | Formamide concentrationd | Source |
|---|---|---|---|---|---|---|
LGC358a | CCATTGTGGAAGATTCCCT | Cy3 | 358-76 | Most lactobacilli | 25-30 | [13], modified |
LGC358b-comp | CCATTGCGGAAGATTCCCT | - | 358-76 | Competitor probe for LGC358a: Staphylococci, Gemella, Granulicatella, Abiotrophia | 25-30 | [13], modified |
LAB759 | CTACCCATRCTTTCGAGCC | Cy3, FAM | 759-77 | Most lactobacilli without L. salivarius group | 30-35 | [8] |
LAB759-comp | CTACCCACGCTTTCGAGCM | - | 759-77 | Competitor probe for LAB759: Many streptococci, β-Proteobacteria, but no lactobacilli | 30-35 | this study |
L-Lbre466-2 | ACCGT CAACCCTTG AACAG | Cy3 | 466-84 | L. brevis | 30-55 | this study |
L-Lbuc438-2 | CACCYG TTCTTCT CCAACA | FAM | 439-57 | L. buchneri (L. hilgardii, L. kefiri, L. parabuchneri) | 50-55 | this study |
Lcas467 | CCGTCACGCCGACAACAG | Cy3, FAM | 467-84 | L. casei, L. paracasei subsp. paracasei, L. rhamnosus, L. zeae | 25-40 | this study |
L-Lcol732-2 | GTTGCAAGCT AGACAG CC | Cy3 | 732-49 | L. coleohominis, L. reuteri (some strains) | ≥30 | this study |
Lfer466 | CCGTCAACGTATGAACAG | Cy3 | 466-83 | L. fermentum | 25 | this study |
Lfer466-H448 | TTACTCTCATACGTGTTC | - | 448-65 | Helper probe for Lfer466 | 25 | this study |
Lfer466-H484 | GCCGTGACTTTCTGGTTAAATA | - | 484-505 | Helper probe for Lfer466 | 25 | this study |
Lgas183 | GACATGCGTCTAGTGTTG | FAM | 183-200 | L. gasserii, L. johnsonii | 25-30 | this study |
Lgas458 | ATAAAGGCCAGTTACTACC | FAM | 458-76 | L. acidophilus L. crispatus, L. gasserii, L. jensenii, L. johnsonii (L. amylolyticus, L. amylovorus, L. fornicalis, L. hamsteri, L. helveticus, L. kefiranofaciens, L. kitasatonis) | 25 | this study |
Lpla759 | CTACCCATACTTTCGAGCC | FAM | 759-77 | L. paraplantarum, L. plantarum, L. pentosus | 20-30 | this study |
Lpla990 | ATCTCTTAGATTTGCATAGTATG | Cy3 | 990-1012 | L. paraplantarum, L. plantarum, L. pentosus | 20-35 | this study |
Lpla990-H1018 | CCCGAAGGGAACGTCTA | - | 1018-34 | Helper probe for Lpla990 | 20-35 | this study |
Lreu986 | GCGCAAGATGTCAAGACC | Cy3, FAM | 986-1004 | L. coleohominis, L. fermentum, L. oris, L. reuterii, L. vaginalis(L. frumenti, L. gastricus, L. ingluviei, L. mucosae, L. panis, L. pontis, L. suebicus) | 25-30 | this study |
Lreu986-H967 | TGGTAAGGTTCTTCGCGTA | - | 967-85 | Helper probe for Lreu986 | 25-30 | this study |
Lsal574 | AAAGACCGCCTGCGTTCCC | Cy3, FAM | 574-92 | L. salivarius (L. acipiscis, L. animalis, L. apodemi, L. murinus, L. ruminis, L. satsumensis, L. vini) | 35-50 | this study |
L-Lsal1113-2 | CTGG CAACTG ACAACAAG | FAM | 1113-30 | L. salivarius (L. agilis, L. equi, L. saerimneri) | 35-45 | this study |
Lvag222 | ACCGCGGGCCCATCCTGA | Cy3 | 222-39 | L. vaginalis | 35-50 | this study |
STR405 | TAGCCGTCCCTTTCTGGT | Cy3 | 405-22 | Streptococci | ≤ 50 | |
LGC358c | CCATTGCCGAAGATTCCCT | FAM | 358-76 | Streptococci | 25-30 | [13], modified |
MIT447 | CACYCGTTCTTCTCTTACA | FAM | 447-65 | Mitis group of streptococci | 25 | |
MUT590 | ACTCCAGACTTTCCTGAC | Cy3 | 590-607 | Streptococcus mutans | 30 | |
L-Ssob440-2 | CACACG TTCTTCCCCT AC | FAM | 440-57 | Streptococcus sobrinus | 45 | this study |
L-Sco/int172-2 | CAGTAAATGTTCTT ATGCG GTA | Cy3, FAM | 172-93 | Streptococcus constellatus, S. intermedius | 40-55 | [39] |
ABI161 | TGCGGTTTTAGCATCCGT | Cy3 | 161-78 | Granulicatella adjacens, G. elegans | ≤ 30 | this study |
ABI1246 | AGTTCGCTGCTCGTTGTA | Cy3 | 1246-63 | Abiotrophia defectiva, Granulicatella adjacens, G. elegans, L. coleohominis (Facklamia hominis, F. languida, F. miroungae) | ≤ 35 | this study |
LCC1030 | CCTGTATCCCGTGTCCCG | Cy3, FAM | 1030-47 | Lactococcus lactis, L. garvieae | 40-55 | this study |
EUB338 | GCTGCCTCCCGTAGGAGT | Cy3, FAM | 338-55 | Most Eubacteria | ≤ 50 | [40] |