Skip to main content
Download PDF

Heterologous expression of the Oenococcus oeni two-component signal transduction response regulator in the Lactiplantibacillus plantarum WCFS1 strain enhances acid stress tolerance

BMC Microbiology volume 24, Article number: 370 (2024) Cite this article

Abstract

Background

Oenococcus oeni is a commercial wine-fermenting bacterial strain, owing to its high efficiency of malolactic fermentation and stress tolerance. The present study explored the function of key genes in O. oeni to enhance stress resistance by heterologous expression of these genes in another species.

Results

The orf00404 gene that encodes a two-component signal transduction response regulator in O. oeni was heterologously expressed in Lactiplantibacillus plantarum WCFS1. The expression of orf00404 significantly enhanced the growth rate of the recombinant strain under acid stress. At 60 h, 72 h, and 108 h of culture at pH 4.0, the recombinant strain had 1562, 641, and 748 differentially expressed genes compared to the control strain, respectively. At all three time points, 20 genes were upregulated in the recombinant strain, including the lamA-D operon-coding genes of the quorum-sensing two component signal transduction system and the spx5 RNA polymerase-binding protein coding gene, which may help adaptation to acid stress. In addition, 47 genes were downregulated in the recombinant strain at all three time points, including the hsp1 heat shock protein-coding gene, the trxA1 thioredoxin-coding gene, and the dinP, mutY, umuC, and uvrB DNA damage repair-related protein-coding genes, potentially indicating that the recombinant strain was less susceptible to stress and had less DNA damage than the control strain in acid stress conditions. The recombinant strain had higher membrane fluidity, permeability, and integrity at an early stage of logarithmic growth (72 h), suggesting that it had a more complete and active cell membrane state at this stage. The intracellular ATP content was significantly reduced in the recombinant strain at the beginning of logarithmic growth (60 h), implying that the recombinant strain consumed more energy at this stage to resist acid stress and growth.

Conclusions

These results indicated that the recombinant strain enhances acid stress tolerance by regulating a gene expression pattern, increasing ATP consumption, and enhancing cell membrane fluidity, membrane permeability, and membrane integrity at specific growth stages. Thus, the recombinant strain may have potential application in the microbial biotechnology industry.

Peer Review reports

Introduction

Wine making is an important component of the food brewing industry, playing an important role in the alcoholic beverage processing field. During the wine-making process, malolactic fermentation (MLF) is an important process that improves the quality of wine [1, 2]. Through MLF, malic acid (a decarboxylated dicarboxylic acid) produces lactic acid (a monocarboxylic acid), which significantly reduces the sour taste of wine [3, 4]. In addition, a series of other metabolic processes occur at the same time with MLF, producing acyl or ester compounds with an aromatic odor, providing a pleasant drinking experience for consumers [5,6,7,8].

The MLF process is mainly initiated and completed by Oenococcus oeni (hereafter called O. oeni), which has adapted to the unique environment of wine during the long evolutionary process [2, 9]. The MLF process usually starts with adverse conditions, such as high ethanol concentration, high acidity (low pH value), and lack of nutrients. These stress conditions inhibit the growth of fermentation microorganisms and hinder the MLF process [10,11,12]. Therefore, it is of great significance to obtain strains with higher stress tolerance using separation, directed evolution, random mutagenesis, or genetic modification [13]. Robust wine-fermenting bacterial strains that can better complete the fermentation process under various stress conditions have greater commercial value.

Among various harsh environments, the acid stress environment of wine is the key stress factor affecting the growth of wine-fermenting bacterial strains, including O. oeni. Previous studies have shown that O. oeni resists acid stress through several mechanisms, such as proton efflux, proton neutralization, protein repair, and DNA repair mechanisms [14,15,16,17,18]. However, the key genes involved in the acid stress response of O. oeni, their activation sequence, and the specific mechanisms need to be further studied. Exploring the key acid stress resistant genes in O. oeni and heterologously expressing them in other fermentation bacterial strains to obtain strains with higher acid stress tolerance are effective means to optimize the fermentation production process.

We have generated a DEa3 mutant from the O. oeni SD-2a strain using directed evolution to obtain significantly enhanced acid stress tolerance. Genome sequencing and comparative genomics technology determined that orf00404 was mutated in DEa3. Genomic annotation of O. oeni SD-2a showed that orf00404 is a two-component signal transduction response regulator. The genome sequence of O. oeni SD-2a indicates that the orf00405 histidine kinase-coding gene is located downstream of orf00404. These two genes may form a two-component signal transduction system. Zhao et al. reported that the expression of the orf00405 gene in O. oeni SD-2a is upregulated by 23-fold under acid and ethanol stress [19], suggesting that this system may play an important role in the adaptation of O. oeni SD-2a to an acid stress environment. Considering that it is difficult to knockout and overexpress genes in O. oeni SD-2a, the Lactiplantibacillus plantarum WCFS1 (hereafter called L. plantarum WCFS1) fermentation bacterial strain, with complete genome sequencing and mature genetic transformation system, was used to investigate the functions of orf00404 during bacterial strain adaptation to acid stress conditions. The recombinant strain was obtained by electroporation of the pIB184-orf00404 recombinant plasmid into L. plantarum WCFS1. To reveal the mechanism of orf00404 enhancing the acid stress tolerance of L. plantarum WCFS1, the growth curve, transcriptome, physiological indicators, and biochemical indicators were evaluated. The present study provides a reference for exploring the function of orf00404 in the acid stress adaptation process of O. oeni and lays a foundation for application of orf00404 in the microbial biotechnology industry.

Materials and methods

Construction of recombinant plasmid and recombinant strain

The O. oeni SD-2a strain (Shandong, China) was cultured in fructose and Tween 80 (FT80) at 30 ℃ to the logarithmic stage, and the cells were centrifuged for genomic DNA extraction. The genomic DNA was extracted using the TIANamp Bacteria DNA kit (TIAGEN, China) according to the manufacturer’s instructions. The orf00404 gene was amplified from genomic DNA using the following primers with BamHI and EcoRI (underlined) restriction sites: orf00404exp-1, 5’-CAATGATGTTGGATCCATGGTAAAACCAATCATTCTTATAATCGAAGATGAGAC-3’; and orf00404exp-2, 5’- TCGAGCTCTAGAATTCTTATTTTGCCCTTAAGACATATCCAACACTACG − 3’. EcoRI and BamHI were used to digest the amplified fragment and pIB184 plasmid. The linearized plasmid and amplified sequence were used to perform a recombination reaction using ClonExpress® II One Step Cloning Kit (Vazyme Biotech, China) according to the manufacturer’s protocol. The recombinant plasmid was then transformed into Escherichia coli Top10, and colony PCR was used to identify positive clones containing the recombinant plasmid. The recombinant plasmid was verified by sequencing and transferred into L. plantarum WCFS1 by electroporation transformation [20].

Acid stress tolerance test

After culturing the WCFS1 pIB184-vector (control) and WCFS1 pIB184-orf00404 (recombinant) strains overnight in Man–Rogosa–Sharp (MRS) medium (pH 6.4), the strains were transferred (1%, v/v) into fresh MRS medium (pH 6.4) and grown until the OD600 reached 1.0. A growth curve was generated by measuring the OD600 value every 12 h at 37℃ under acid stress MRS medium (pH 3.8, 4.0, and 4.2) with the same inoculum. The effects of the orf00404 gene on L. plantarum WCFS1 acid stress tolerance were analyzed.

Transcriptome assay

The WCFS1 pIB184-vector (control) and WCFS1 (pIB184-orf00404 (recombinant) strains were cultured in MRS medium under pH 4.0, and the cells were centrifuged at 60 h, 72 h, and 108 h. Total RNA was extracted from the collected samples using the Bacteria RNA Extraction Kit (Vazyme Biotech, China) according to the manufacturer’s protocol, and the concentration and purity of the extracted RNA were evaluated using a Nanodrop 2000. RNA integrity was detected by agarose gel electrophoresis, and the RNA integrity number (RIN) was determined by an Agilent 2100 Bioanalyzer using the RNA 6000 series II Nano LabChip analysis kit (Agilent Technologies, USA) according to manufacturer’s recommendations. The total amount of RNA used for a single library construction was 2 µg, with a concentration ≥ 100 ng/µL and an OD260/280 between 1.8 and 2.2. Sequence libraries were generated and sequenced by Shanghai Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China), using the Illumina Hiseq sequencing platform. The raw data was subjected to quality control to obtain clean reads and then compared with the reference genome to obtain mapped reads for subsequent analysis. After performing a basic functional annotation of the predicted coding genes, the expression levels of genes and transcripts were quantitatively analyzed according to RNASeq by Expectation Maximization (RSEM), and the quantitative index was transcripts per million reads (TPM). DESeq2 (https://www.bioconductor.org/packages/release/bioc/html/DESeq2.html) was used to analyze the differential expression of genes among samples, and the differentially expressed genes were identified. Microsoft Excel software was used to filter the upregulated or downregulated genes at the three time points (60 h, 72 h, and 108 h).

Cell membrane fluidity measurement

After culturing the cells overnight in MRS medium, the cells were transferred (1%, v/v) into fresh MRS medium and grown until the OD600 reached 1.0, and the cells were then cultured in pH 4.0 MRS medium with an initial OD600 = 0.1. Samples were collected by centrifugation (3000 rpm, 15 min) at 0 h (before acid stress), 60 h, 72 h, and 108 h. All collected samples were adjusted to OD600 = 0.6. The samples were treated with 0.25% formaldehyde at 37 ℃ for 30 min and washed twice with 0.2 M phosphate buffer saline (pH 7.4, containing 0.25% formaldehyde). For the determination of lateral diffusion, the cells were labeled with 0.1 µM pyrene at 37℃ for 40 min, and the fluorescence intensity was measured by a fluorescence spectrophotometer (F4700, Hitachi, Japan), with an excitation wavelength of 335 nm, emission wavelength of 373 nm (monomer), emission wavelength of 470 nm (dimer), and slit of 5 nm.

Membrane permeability measurement

For measurement of membrane permeability, the cell culture and collection times were the same as those for the cell membrane fluidity measurement. The cells were collected by centrifugation (3000 rpm, 15 min) and resuspended in 10 mmol/L phosphate buffer saline (pH 7.4), and the OD600 was adjusted to 1. Then, 10 µL of 5 mmol/L p-nitrophenyl-α-D-galactopyranoside (pNPG) was added, followed by incubation at 37℃. After 2 h, readings were taken at 420 nm using an ultraviolet (UV)- visible spectrophotometer (UV-5500, Shanghai Yuanjie Instrument Co., Ltd., China).

Membrane integrity measurement

For the membrane integrity measurement, the cells were cultured and collected using the same procedures for the cell membrane fluidity measurement. The cells were washed twice with phosphate buffer saline (pH 7.4), and the concentration of the bacteria was adjusted to 1 × 108 CFU/mL. Propidium iodide (PI) solution with a final concentration of 50 µg/mL was added to the cells, followed by incubation for 30 min in the dark at 37℃. The cells were evaluated using a full-wavelength multifunctional microplate reader (Tecan, Männedorf, Switzerland). The excitation wavelength was 488 nm, and the fluorescence intensity was measured at 630 nm.

Intracellular ATP content and H+-ATPase activity determination

For ATP content and H+-ATPase activity determination, the culture and collection times were the same as those for the cell membrane fluidity measurement. The cells were collected by centrifugation (12000 rpm, 4℃, 2 min), washed with phosphate buffer saline (pH 7.0), and resuspended. The cells were lysed with an ultrasonic apparatus in an ice bath (VCX130PB, Sonics, USA), using the following ultrasonic conditions: 40% power, 20 min, working time of 5 s, and intermittent time 5 s. The supernatant was collected and used to determine the ATP content and H+-ATPase activity using an ATP content detection kit (Beijing Solarbio Science & Technology Co., Ltd., China) and Microorganism H+-ATPase ELISA test kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., China) [21].

Results

Heterologous expression of orf00404 in L. Plantarum WCFS1

The amplified orf00404 fragment and digested pIB184 plasmid were separated by agarose gel electrophoresis (Fig. S1A-B) and ligated to generate the pIB184-orf00404 recombinant plasmid, which was transformed into E. coli Top10. Colony PCR was performed to identify positive clones (Fig. S1C), as indicated by 897 bp bands in agarose gels (lanes 2–5). The correctly sequenced recombinant plasmid and pIB184 plasmid were extracted and transferred into L. plantarum WCFS1 by electroporation (Fig. S1D). The colony PCR results for the recombinant WCFS1 strain are shown in Figure S1E. The positive clone bands are shown in lanes 1–10. The schematic for construction of the recombinant plasmid is shown in Fig. 1.

Fig. 1
figure 1

Schematic diagram of the construction process of recombinant plasmid

Full size image

Heterologous expression of orf00404 significantly increases the growth rate of L. Plantarum WCFS1 under acid stress

To investigate the effects of heterologous expression of orf00404 on the growth rate of L. plantarum WCFS1, the growth curves of the control strain and recombinant strain were measured under normal culture conditions (pH 6.4) and acid stress conditions (pH 3.8, pH 4.0, and pH 4.2). Under normal culture conditions, there was no significant difference in the growth rates of the recombinant strain and control strain (Fig. 2). At pH 3.8, the growth rates of both the recombinant and control strain significantly decreased, and the degree of inhibition of the control strain was greater than that of the recombinant strain. The recombinant strain entered the logarithmic growth phase after 144 h of acid stress treatment, while the control strain remained in the lag phase. The growth rates of the recombinant strain and control strain under pH 4.0 and pH 4.2 were significantly higher than those under acid stress at pH 3.8, and the growth rates of the recombinant strain were significantly higher than the control strain under all acid stress conditions. According to the growth curve measurements, pH 4.0 was selected for the transcriptome, physiological, and biochemical analyses.

Fig. 2
figure 2

The growth curve of WC_S1(pIB184-vector) and WCFS1(pIB184-orf00404) cultured in MRS medium at pH 3.8 (A), pH 4.0 (B), pH 4.2 (C) and pH6.4 (D) conditions

Full size image

Heterologous expression of orf00404 significantly changes the gene expression pattern of L. Plantarum WCFS1 under acid stress

To explore the effect of heterologous expression of orf00404 in L. plantarum WCFS1 at the transcriptional level, samples of the control and recombinant strains were collected at 60 h, 72 h, and 108 h under acid stress conditions (pH 4.0). A volcano plot was generated to visualize the gene expression pattern, including upregulated genes, downregulated genes, and genes that were not significantly changed (Fig. 3). Figure 4 shows the number of significantly upregulated and downregulated genes at the corresponding time points. Compared to the control strain, there were 770 significantly upregulated genes and 792 significantly downregulated genes in the recombinant strain at 60 h (Fig. 4A). At 72 h, there were 334 significantly upregulated genes and 307 significantly downregulated genes in the recombinant strain. At 108 h, there were 383 significantly upregulated genes and 365 significantly downregulated genes in the recombinant strain. The functional annotation classification of the upregulated and downregulated genes is shown in Fig. 4B. At 60 h, most of the upregulated genes were classified as metabolism-related genes, while most of the downregulated genes were classified as poorly characterized. Most of the upregulated or downregulated genes at 72 h were classified as metabolism-related genes. At 108 h, most of the upregulated genes were classified as poorly characterized, while most of the downregulated genes were classified as metabolism-related genes. These data showed that the gene expression patterns of the two strains dynamically changed at the different time points to adapt to the growth conditions of different microenvironments.

Fig. 3
figure 3

Volcano plots of gene expression differences between the recombinant strain WCFS1 (pIB184-orf00404) and the control strain WCFS1 (pIB184-vector) cultured under pH 4.0 conditions for 60 h (A), 72 h (B), and 108 h (C). Note that in the figure, pIB-orf00404 and pIB-vector represent the recombinant strain WCFS1 (pIB184-orf00404) and the control strain WCFS1 (pIB184-vector), respectively

Full size image
Fig. 4
figure 4

The totally different expression gene numbers (A) and specific number distributed in COG categories of different expression genes (B) in WCFS1(pIB184-vector) and WCFS1(pIB184-orf00404) cultured under pH 4.0 conditions for 60 h, 72 h, and 108 h

Full size image

To identify the upregulated or downregulated genes in the recombinant strain at the time points (60 h, 72 h, and 108 h ) compared with the control strain, the gene numbers and specific categories from all the differentially expressed genes were filtered and analyzed using Microsoft Excel. Table 1 summarizes the gene categories significantly upregulated or downregulated in the recombinant strain at 60 h, 72 h and 108 h. A total of 20 genes were significantly upregulated at all three time points, and these genes were subdivided into 7 categories of clusters of orthologous gene (COG) functional annotations. The genes most upregulated in the signal transduction mechanism class contained an operon encoding the lamA-lamD (Lactobacillus agr-like module) quorum-sensing two-component signal transduction system. These genes have been reported to be associated with the cell surface structure [22,23,24]. In addition, the potassium absorption protein-coding gene (kup1), the Spx subfamily protein-coding gene (lp_3579), the MdxE-coding gene (lp_0175), and the MATE family protein-coding gene (lp_1386) were significantly upregulated at all three time points. All homologous proteins mentioned above have been reported to be involved in the process of stress resistance in other species [25,26,27,28]. Three genes related to amino acid or nucleotide metabolism were significantly upregulated in the recombinant strain, namely, ansB (lp_2830), asnB2 (lp_3085), and adeC (lp_3334), which suggested that specific steps of amino acid and nucleotide metabolism were altered in the recombinant strain. In addition, there were nine genes encoding unknown functional proteins significantly upregulated in the recombinant strain, which may play an important role in the resistance of the recombinant strain to an acid stress environment.

Table 1 The significantly up/down regulated genes in WCFS1(pIB184-orf00404) compared with WCFS1(pIB184-vector) cultured under pH 4.0 conditions for 60 h, 72 h, and 108 h. Microsoft Excel software was used to filter and stat these gene numbers and specific categories from the whole different expression genes
Full size table

Compared with the control strain, 47 genes were significantly downregulated in the recombinant strain at all three time points, and they were subdivided into 12 categories of COG functional annotations. Some common stress response protein-coding genes, such as hsp1 and trxA1, as well as DNA damage repair protein-coding genes, such as dinP, mutY, umuC, and uvrB, were downregulated at all three time points. These results suggested that the recombinant strain was less susceptible to stress and had less DNA damage than the control strain. The expression levels of several protein-coding genes related to cell surface structure or polysaccharide metabolism were significantly downregulated in the recombinant strain at the three time points, including the cps3A glycosyltransferase-coding gene, the cps3I o-acetyltransferase-coding gene, the lp_3072/lp_3074 cell surface protein precursor CscA/CscD family-coding gene, and the lp_3452/lp_3075 cell surface protein CscB/CscC family-coding gene. The specific physiological functions of these proteins in L. plantarum remain unclear, but the selective downregulation of some homologous protein-coding genes in the recombinant strain may help the recombinant strain adapt to the stress environment by changing the cell surface structure and sugar content. Two transcriptional regulators were significantly downregulated in the recombinant strain at all three time points, namely, a MarR family transcriptional regulator (encoded by lp_3344) and a Crp/FNR family transcriptional regulator (encoded by lp_0103). Downregulating the expression of the gene encoding MarR may be beneficial to the adaptability of the recombinant strain under stressful environmental conditions. Downregulating the lp_0103 gene may reduce the ratio of D-lactic acid to L-lactic acid in L. plantarum. In addition, pyruvate oxidase-coding genes (poxC and poxE), three NADPH/ FMN-dependent enzyme proteins [belonging to the NADPH-dependent FMN reductase protein family (encoded by lp_0244), the FMN dependent NADH-azo reductase protein family (encoded by azoR2 and lp_0955), and pyridoxamine 5’-phosphate oxidase-related FMN-binding protein (encoded by lp_0091)], and several unknown genes were significantly downregulated in the recombinant strain at all three time points. Further research is needed to investigate the impact of these genes on the ability of the recombinant strain to resist acid stress.

Heterologous expression of orf00404 enhances the cell membrane fluidity, permeability, and integrity of the recombinant strain at a specific time

Various stress conditions, including acid stress, usually change the physicochemical properties of the cell membrane. To explore the effects of acid stress on the cell membranes of the recombinant and control strains, the cell membrane fluidity, permeability, and integrity were measured at 0 h, 60 h, 72 h, and 108 h. Pyrene was used as a cell membrane probe, and the fluidity of the cell membrane was represented according to the measured fluorescence intensity ratio (Ka). As shown in Fig. 5A, the cell membrane fluidity of the recombinant and control strains under pH 4.0 acid stress were significantly reduced compared with pH 6.4 culture conditions. These results agreed with previous reports, demonstrating that the cell membrane adjusts the content ratio of different fatty acids to increase the hardness and reduce the fluidity of the cell membrane when cells are subjected to acid stress or low-temperature stress [29]. Compared with the control strain, the cell membrane fluidity of the recombinant strain was higher at 0 h but significantly lower at 60 h. These findings indicated that the changes in cell membrane hardness were higher in the recombinant strain and that the defense response to acid stress was more intense in the recombinant strain. At 72 h and 108 h, the cell membrane fluidity of the recombinant strain was significantly higher than that of the control strain. These results suggested that the recombinant strain had fully adapted to the acid stress environment at these two time points, and the high cell membrane fluidity was conducive to the exchange of substances inside and outside the cell, increasing the metabolism of substances and the cell growth rate. The permeability of living cells can be measured using pNPG, which is a substrate of β-D-galactosidase. β-D-galactosidase penetrates cells when the permeability of the cell membrane increases to a specific level. pNPG has a peak absorption at wavelength 420 nm, allowing the permeability change of the cell membrane to be expressed according to the absorption value of the treated cells at 420 nm. As shown in Fig. 5B, there was no significant difference in membrane permeability between the recombinant strain and control strain at 0 h, and the membrane permeability of both strains decreased at 60 h after acid stress treatment, which may be due to an increase in membrane hardness and a decrease in permeability due to acid stress treatment. The cell membrane permeability of the recombinant strain was significantly higher than that of the control strain at 60 h and 72 h, but it was significantly lower at 108 h. At 72 h, the recombinant strain was in the early stage of logarithmic growth, and the control strain was in the lag phase. At this time, the growth and metabolism rate of the recombinant strain were significantly faster than those of the control strain. Therefore, the cell membrane fluidity and permeability of the recombinant strain were significantly higher, which allowed accelerated exchange of substances inside and outside the cell to support metabolic growth. As shown in Fig. 5C, PI was used to stain cells only with damaged cell membranes, which allowed the integrity of the cell membrane to be analyzed by measuring the fluorescence intensity. There was no significant difference in membrane integrity between the recombinant strain and control strain at 0 h, 60 h, and 108 h, and the recombinant strain had significantly higher membrane integrity than the control strain at 72 h, which was conducive to metabolic growth. Together, these data showed that the cell membrane fluidity, permeability, and integrity of the recombinant and control strains showed dynamic changes at different time points of acid stress treatment. Compared to the control strain at 72 h of acid stress treatment, the recombinant strain had higher cell membrane fluidity, permeability, and integrity, which enhanced the exchange of substances, energy, and signals inside and outside of the recombinant strain cells, thus promoting rapid cell growth.

Fig. 5
figure 5

Measurement of cell membrane fluidity (A), permeability (B), and integrity (C) in WCFS1(pIB184-vector) and WCFS1(pIB184-orf00404) strains cultured under pH 6.4 (0 h) and pH 4.0 conditions for 60 h, 72 h, and 108 h. Asterisk means T-test of p-value < 0.05

Full size image

Effects of heterologous expression of orf00404 on the intracellular ATP content and H+-ATPase activity of the recombinant strain

The ATP content and intracellular H+-ATPase activity are two important indicators of stress resistance and growth of L. plantarum WCFS1. In the present study, the intracellular ATP content and intracellular H+-ATPase activity of both the recombinant strain and control strain were measured at 0 h, 60 h, 72 h, and 108 h. As shown in Fig. 6A, the intracellular ATP content of the recombinant strain was slightly higher than that of the control strain at 0 h, 72 h, and 108 h, but there was no significant difference in the intracellular ATP content between the two strains at 0 h and 72 h. The intracellular ATP content of the recombinant strain was significantly lower than that of the control strain at 60 h.

Fig. 6
figure 6

ATP content (A) and H+-ATPase activity (B) of WCFS1(pIB184-vector) and WCFS1(pIB184-orf00404) strains cultured under pH6.4 (0 h) and pH 4.0 conditions for 60 h, 72 h, and 108 h. Asterisk means T-test of p-value < 0.05

Full size image

Figure 6B shows the H+-ATPase activities of the recombinant and control strains at different time points. The H+-ATPase activities of the two strains were not significantly different at 0 h, 60 h, and 72 h, but the H+-ATPase activity of the recombinant strain was significantly lower than that of the control strain at 108 h. Although the transcriptomic data showed that the expression of the H+-ATPase-coding gene in the recombinant strain was significantly higher than that of the control strain at 60 h, and the activity of H+-ATPase in the recombinant strain was not significantly different from that in the control strain at 60 h. However, the intracellular ATP content was significantly lower in the recombinant strain than that of the control strain, indicating that the energy requirement of the recombinant strain was greater than that of the control strain at 60 h.

Discussion

The present study investigated the function of orf00404 (a two-component signal transduction response regulator of O. oeni) in promoting the tolerance to acid stress conditions by heterologous expression in L. plantarum WCFS1. Analysis of the growth curve showed that the expression of orf00404 significantly enhanced the growth rate of the recombinant strain under acid stress compared with the control strain. To elucidate the specific effects of heterologous expression of orf00404 in L. plantarum WCFS1 under acid stress, transcriptome, physiological, and biochemical analyses were conducted.

The amino acid sequence of orf00404 was used to search for homologous sequences of orf00404 in other species through NCBI Basic Local Alignment Search Tool (BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi). The orf00404-coding protein had high homology with YkoG, a two-component signal transduction system response transcription regulator in Bacillus subtilis, and the signal response histidine kinase of this two-component signal transduction system is YkoH, which has high homology with the downstream orf00405-coding protein. These findings suggested that orf00404 and orf00405 form a two-component signal transduction system in O. oeni. The YkoH/YkoG two-component signal transduction system can regulate the expression of the yvtB stress response protein-coding gene in B. subtillis, but its specific regulatory mechanism remains unclear [30, 31]. The growth curve results under acid stress in the present study indicated that heterologous expression of orf00404 enhanced the growth rate of the recombinant strain under acid stress conditions compared to the control strain. Orf00404 may have enhanced the acid stress tolerance of the recombinant strain by directly or indirectly regulating the expression of certain stress response genes.

The transcriptome data indicated that at 60 h, 72 h, and 108 h, the numbers and categories of differentially expressed genes significantly varied in the recombinant and control strains, which suggested that the recombinant strain adjusted the gene expression pattern at different growth stages to adapt to an acid stress environment. Compared to the control strain, the recombinant strain had 20 significantly upregulated and 47 significantly downregulated genes at all the three time points, implying that these genes were consistently regulated to better help the recombinant strain tolerate acid stress.

The lamA-lamD operon, encoding the quorum-sensing two-component signal transduction system (Lactobacillus agr-like module), was among the upregulated genes in the recombinant strain. Previous studies have reported that this operon encodes the following four proteins: lamC and lamA encode histidine kinase and response transcription regulator, respectively; lamD encodes the precursor protein of self-inducible peptide segment; and lamB encodes the LamD modified processing protein, which helps LamD to produce a mature self-inducible peptide segment [22,23,24]. Studies on lamA knockout mutants have shown that the adhesion of lamA mutants is significantly reduced compared to wild type and that the cell surface structure is significantly changed [22,23,24]. DNA microarray transcription analysis has also indicated different gene expression profiles between wild type and lamA mutants according to these reports. Compared to wild type, the expression of cps2 (lp_1197 to lp_1211), an operon encoding the synthesis of surface polysaccharides, is significantly upregulated in lamA mutants [22, 24]. Moreover, the following genes are downregulated in lamA mutants: kup1 (lp_0525), a gene encoding a potassium absorption protein; asp1 and asp2, genes that encode alkali stress proteins; and clpL, a gene that encodes ATP-dependent Clp protease components [22, 24]. In the present study, the expression of kup1 was significantly upregulated at all three time points in the recombinant strain, whereas the expression of asp1, asp2, and clpL was significantly upregulated at 72 h and 108 h, suggesting that orf00404 may affect the expression of the above genes by regulating the expression of lamA-lamD operons. Other studies have reported that the expression of kup1 in L. plantarum ST-III is significantly upregulated under salt stress [32], and the expression of the Asp1 and Asp2 alkali stress proteins is significantly upregulated when L. plantarum 423 is subjected to acid stress [33]. In addition, ClpL degrades denatured proteins under various stress conditions and reduces their cytotoxicity [34]. These results suggest that the proteins encoded by these genes may play roles in reducing the damage of cells under stress conditions.

The Spx subfamily (encoded by lp_3579), MdxE (encoded by lp_0175), and MATE family (encoded by lp_1386) proteins were also significantly upregulated at all three time points in the present study. It has been reported that Spx binds to the C-terminal domain (α-CTD) of the RNA polymerase α-subunit to activate or inhibit downstream gene expression [25, 27]. Spx also regulates the expression of genes involved in the resistance to heat stress, cell wall stress, ethanol stress, and oxidation stress [25, 27]. There are five Spx homologous protein-coding genes (spx1-5) in the genome of L. plantarum WCFS1. The present study demonstrated that only spx5 (lp_3579) was significantly upregulated at all three time points, indicating that this gene may play an important role in the adaptation of the recombinant strain to acid stress environment. MdxE is the ABC transporter of maltodextrin. Previous studies have shown that adding an appropriate amount of maltodextrin to the culture of L. plantarum Lp-115 significantly enhances the tolerance of the strain to bile acid stress [28]. Kuroda et al. reported that MATE family proteins are multidrug efflux transporters, which export various antibiotics and other toxic substances to reduce their harm to cells [26], but their specific roles under acid stress remain unclear.

In the present study, three genes, including ansB (lp_2830), asnB2 (lp_3085), and adeC (lp_3334), related to amino acid or nucleotide metabolism were significantly upregulated in the recombinant strain. ansB encodes aspartate ammonia lyase, which catalyzes the reversible conversion of L-aspartate and fumaric acid [35]. asnB2 encodes asparagine synthetase, which catalyzes the synthesis of asparagine and glutamine from aspartic acid and glutamine, but there are also reports that asnB2 encodes homologous proteins to catalyze the amidation of peptidoglycan components of the cell wall [36, 37]. adeC encodes adenine deaminase, and it catalyzes the deamination of adenine to produce hypoxanthine, which is an important reaction in nucleotide metabolism [38]. Further study is required to determine whether the upregulated expression of these enzyme-coding genes is conducive to the resistance of the recombinant strain to acid stress environment.

Nine other genes encoding unknown functional proteins were significantly upregulated in the recombinant strain, and the role of these genes in the recombinant strain under acid stress environment remains unclear. At 60 h and 72 h, many lipid-, amino acid-, nucleotide transport-, and metabolism-related genes were significantly upregulated in the recombinant strain (data not shown), which suggested that various metabolic processes of the recombinant strain were relatively active at these two time points, corresponding to the growth curve. The recombinant strain required less time to transition from maintaining a cell survival state to promoting a cell rapid growth state. These results suggested that heterologous expression of orf00404 in L. plantarum WCFS1 significantly upregulates some stress response-related genes, and these genes may play important roles in helping the recombinant strain adapt to the acid stress environment and promote cell growth.

In the present study, 47 genes were significantly downregulated in the recombinant strain at all three time points compared with the control strain. At 60 h, the expression levels of most stress response protein-coding genes, such as hsp2, hsp3, groES, groEL, dnaK, ftsH, clpX, clpP, trxA1, and recA, were significantly lower in the recombinant strain compared to the control strain (data not shown) [39,40,41,42,43,44,45,46]. Combined with the higher expression levels of metabolic genes in the recombinant strain at 60 h, these results indicated that the recombinant strain was fully adapted to the stress growth environment at 60 h, and the cells shifted from a lag phase dominated by stress resistance to a rapid growth phase.

The present study demonstrated that several protein-coding genes related to cell surface structure or polysaccharide metabolism were significantly downregulated in the recombinant strain. Previous studies have reported that there are four gene clusters, namely, cps1A-I, cps2A-J, cps3A-J, and cps4A-J, involved in generating the L. plantarum WCFS1 surface polysaccharide products. Mutant analysis has shown that the lack of the cps1 gene cluster reduces the molar molecular weight of rhamnose in the polysaccharide of the cell surface, and the lack of the cps2/3/4 gene cluster reduces the polysaccharide content of the cell surface [47]. The present study demonstrated that the recombinant strain reduced the expression of some coding genes in the cps3 gene cluster at the three time points, which may have changed the polysaccharide content of the cell surface layer. Siezen et al. showed that CscA/CscB/CscC/CscD homologous cell surface proteins are encoded by nine gene clusters in L. plantarum WCFS1 [48]. CscA family proteins usually contain an DUF916 domain and a transmembrane domain in the C-terminal end, while both CscB and CscC contain an WxL domain [48]. Studies in Enterococcus have shown that proteins containing the WxL domain interact with the extracellular matrix, and knockout of protein-coding genes containing the WxL domain significantly enhances the adaptability of this bacterium to a bile acid stress environment [48, 49]. CscD contains an LPXTG motif, which can be covalently anchored to a peptidoglycan matrix [48]. The specific physiological functions of these proteins in L. plantarum remain unclear and need further study.

The present study demonstrated that two transcriptional regulators belonging to the MarR family and Crp/FNR family were significantly downregulated in the recombinant strain at the three time points. MarR family members are regulators of antibiotic tolerance and usually act as transcriptional suppressors to inhibit downstream gene expression, such as inhibiting the expression of the gene encoding the drug efflux pump in E. coli [50]. MarR family proteins can bind to small ligands or release the inhibition of downstream gene expression after sensing oxidative stress. As downstream genes regulated by MarR usually play a role under stress conditions, the removal of inhibition or knockout of the transcriptional regulatory factor under stress conditions is more conducive to cell adaptation to the stress environment [51]. Downregulating the expression of the gene encoding MarR may be beneficial to the adaptability of the recombinant strain under stressful environmental conditions. Desguin et al. showed that lp_0103 encodes an operon transcription activator belonging to the Crp/FNR family for lactate racemase, which catalyzes the conversion of L-lactic acid to D-lactic acid, in L. plantarum WCFS1 [52]. Downregulating this gene may reduce the ratio of D-lactic acid to L-lactic acid in L. plantarum.

At the three time points, the poxC and poxE pyruvate oxidase-coding genes, as well as three NADPH/FMN-dependent enzyme proteins and several genes with unknown function, were downregulated in the recombinant strain. The correlation between the downregulation of these genes and better adaptability of the recombinant strain under acid stress conditions needs further study.

The present study indicated that the physicochemical properties of the cell membrane in both the recombinant and control strains continuously changed at different time points, suggesting that both strains adapt to acid stress environments by regulating the cell membrane fluidity, integrity, and permeability. At 72 h, the recombinant strain had higher membrane fluidity, permeability, and integrity compared with the control strain, which may be due to the recombinant strain being in an early stage of logarithmic growth compared to the control strain being in the lag phase. The higher membrane fluidity, permeability, and integrity accelerated the exchange of substances inside and outside the cells to support the rapid growth of the recombinant strain.

In the present study, the intracellular ATP content of the recombinant strain was significantly lower than that of the control strain at 60 h. Studies have shown that under stress conditions, cells need to consume more ATP to fight against the stress environment and maintain cell activity and growth [23, 53, 54]. According to the growth data, the recombinant strain was at the critical point of lag and logarithmic phase at 60 h. The transcriptomic data indicated that the expression of genes encoding intracellular stress and DNA damage repair proteins in the recombinant strain were significantly downregulated compared with the control strain at 60 h. Moreover, the expression of genes related to lipid metabolism, carbohydrate metabolism, and amino acid metabolism were significantly upregulated in the recombinant strain, indicating that the cell state of the recombinant strain had shifted from stress resistance to rapid metabolic growth at 60 h. Compared to the control strain, the energy demand and consumption of the recombinant strain were significantly higher at 60 h, which may explain why the ATP content of the recombinant strain was significantly lower than that of the control strain. Further, the H+-ATPase activity of the recombinant strain was significantly lower than that of the control strain at 108 h, at which time the recombinant strain was in the late logarithmic growth stage and the control strain was in the early logarithmic growth stage. The H+-ATPase activity is expected to be higher at the early logarithmic growth stage. These data indicated that heterologous expression of orf00404 had no significant effect on ATP content and intracellular H+-ATPase activity of the recombinant strain at most detection time points. However, the differences of ATP content and intracellular H+-ATPase activity between the recombinant strain and control strain at specific time points were affected by other factors, such as cell growth status.

Conclusion

In the present study, the orf00404 gene from O. oeni SD-2a, encoding a two-component signal transduction system response transcription regulator, was heterologously expressed in L. plantarum WCFS1. Growth curve, transcriptomic, physiological, and biochemical analyses demonstrated that orf00404 regulates gene expression patterns, increases ATP consumption, and enhances cell membrane fluidity, permeability, and integrity of the recombinant L. plantarum strain at the initial logarithmic stage to improve acid stress tolerance. The present study indicates the functional role of orf00404 under acid stress conditions, suggesting potential application of orf00404 in the microbial biotechnology industry.

Data availability

The datasets generated and analysed during the current study are available in the GenBank repository, accession numbers are PRJNA779871 for the whole-genome sequence of Oenococcus oeni strain SD-2a and PRJNA1106376 for RNA sequence data of biosamples in this study.

Abbreviations

ATP:

Adenosine triphosphate

DNA:

Deoxyribonucleic acid

FT80:

Fructose and Tween 80

MLF:

malolactic fermentation

MRS:

Man–Rogosa–Sharp

NADPH:

Reduced form of nicotinamide-adenine dinucleotide phosphate

PBS:

Phosphate Buffered Solution

PCR:

Polymerase chain reaction

pNPG:

p-nitrophenyl-α-D-galactopyranoside

RIN:

RNA Integrity Number

RNA:

Ribonucleic acid

RSEM:

RNASeq by Expectation Maximization

TPM:

Transcripts Per Million reads

UV:

Ultraviolet

References

  1. Bartowsky EJ. Oenococcus oeni and the genomic era. FEMS Microbiol Rev. 2017;41(Supp1):S84–94.

    Article  PubMed  Google Scholar 

  2. Lonvaud-Funel A. Lactic acid bacteria in the quality improvement and depreciation of wine. Lactic Acid Bacteria: Genetics, Metabolism and Applications: Proceedings of the Sixth Symposium on Lactic Acid Bacteria: Genetics, Metabolism and Applications, 19–23 September 1999, Veldhoven, The Netherlands. Springer Netherlands, 1999; 317–331.

  3. Bartowsky EJ, Borneman AR. Genomic variations of Oenococcus oeni strains and the potential to impact on malolactic fermentation and aroma compounds in wine. Appl Microbiol Biot. 2011;92:441–7.

    Article  CAS  Google Scholar 

  4. Krieger-Weber S, Heras JM, Suarez C. Lactobacillus plantarum, a new biological tool to control malolactic fermentation: a review and an outlook. Beverages. 2020;6(2):23.

    Article  CAS  Google Scholar 

  5. Bianchi A, Taglieri I, Venturi F, Sanmartin C, Ferroni G, Macaluso M, et al. Technological improvements on FML in the chianti classico wine production: co-inoculation or sequential inoculation? Foods. 2022;11(7):1011.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Cappello MS, Zapparoli G, Logrieco A, Bartowsky EJ. Linking wine lactic acid bacteria diversity with wine aroma and flavour. Int J Food Microbiol. 2017;243:16–27.

    Article  CAS  PubMed  Google Scholar 

  7. Wang C, Sun S, Zhou H, Cheng Z. The influence of lactiplantibacillus plantarum and Oenococcus oeni starters on the volatile and sensory properties of black raspberry wine. Foods. 2023;12(23):4212.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Zhang S, Xing X, Chu Q, Sun S, Wang P. Impact of co-culture of Lactobacillus plantarum and Oenococcus oeni at different ratios on malolactic fermentation, volatile and sensory characteristics of mulberry wine. LWT. 2022;169:113995.

    Article  CAS  Google Scholar 

  9. Liu L, Peng S, Song W, Zhao H, Li H, Wang H. Genomic analysis of an excellent wine-making strain SD-2a. Pol J Microbiol. 2022;71(2):279–92.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Bartowsky EJ. Bacterial spoilage of wine and approaches to minimize it. Lett Appl Microbiol. 2009;48(2):149–56.

    Article  CAS  PubMed  Google Scholar 

  11. Contreras Á, Díaz G, Mendoza SN, Canto M, Agosín E. Metabolic behavior for a mutant Oenococcus oeni strain with high resistance to ethanol to survive under oenological multi-stress conditions. Front Microbiol. 2023;14:1100501.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Ruiz-de-Villa C, Poblet M, Bordons A, Reguant C, Rozès N. Comparative study of inoculation strategies of Torulaspora delbrueckii and Saccharomyces cerevisiae on the performance of alcoholic and malolactic fermentations in an optimized synthetic grape must. Int J Food Microbiol. 2023;404:110367.

    Article  CAS  PubMed  Google Scholar 

  13. Patnaik R. Engineering complex phenotypes in industrial strains. Biotechnol Progr. 2008;24(1):38–47.

    Article  CAS  Google Scholar 

  14. Bech-Terkilsen S, Westman JO, Swiegers JH, Siegumfeldt H. Oenococcus oeni, a species born and moulded in wine: a critical review of the stress impacts of wine and the physiological responses. Aust J Grape Wine R. 2020;26(3):188–206.

    Article  CAS  Google Scholar 

  15. Chen Q, Yang X, Meng Q, Zhao L, Yuan Y, Chi W, et al. Integrative multiomics analysis of the acid stress response of Oenococcus oeni mutants at different growth stages. Food Microbiol. 2022;102:103905.

    Article  CAS  PubMed  Google Scholar 

  16. De Angelis M, Gobbetti M. Environmental stress responses in Lactobacillus: a review. Proteomics. 2004;4(1):106–22.

    Article  PubMed  Google Scholar 

  17. Margalef-Català M, Araque I, Weidmann S, Guzzo J, Bordons A, Reguant C. Protective role of glutathione addition against wine-related stress in Oenococcus oeni. Food Res Int. 2016;90:8–15.

    Article  PubMed  Google Scholar 

  18. Margalef-Català M, Araque I, Bordons A, Reguant C. Genetic and transcriptional study of glutathione metabolism in Oenococcus oeni. Int J Food Microbiol. 2017;242:61–9.

    Article  PubMed  Google Scholar 

  19. Zhao H, Liu L, Yuan L, Hu K, Peng S, Li H, et al. Mechanism analysis of combined acid-and-ethanol shock on Oenococcus oeni using RNA-Seq. Eur Food Res Technol. 2020;246:1637–46.

    Article  CAS  Google Scholar 

  20. Teresa Alegre M, Carmen Rodriguez M, Mesas JM. Transformation of Lactobacillus plantarum by electroporation with in vitro modified plasmid DNA. FEMS Microbiol Lett. 2004;241(1):73–7.

    Article  CAS  PubMed  Google Scholar 

  21. Cui T, Zhang Y, Qin G, Wei Y, Yang J, Huang Y, et al. A neutrophil mimicking metal-porphyrin-based nanodevice loaded with porcine pancreatic elastase for cancer therapy. Nat Commun. 2023;14(1):1974.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Fujii T, Ingham C, Nakayama J, Beerthuyzen M, Kunuki R, Molenaar D, et al. Two homologous agr-like quorum-sensing systems cooperatively control adherence, cell morphology, and cell viability properties in Lactobacillus plantarum WCFS1. J Bacteriol. 2008;190(23):7655–65.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Liu J, Huang TY, Liu G, Ye Y, Soteyome T, Seneviratne G, et al. Microbial interaction between lactiplantibacillus plantarum and Saccharomyces cerevisiae: transcriptome level mechanism of cell-cell antagonism. Microbiol Spectr. 2022;10(5):e01433–22.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Sturme MHJ, Nakayama J, Molenaar D, Murakami Y, Kunugi R, Fujii T, et al. An agr-like two-component regulatory system in Lactobacillus plantarum is involved in production of a novel cyclic peptide and regulation of adherence. J Bacteriol. 2005;187(15):5224–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Cheng C, Han X, Xu J, Sun J, Li K, Han Y, et al. YjbH mediates the oxidative stress response and infection by regulating SpxA1 and the phosphoenolpyruvate-carbohydrate phosphotransferase system (PTS) in Listeria monocytogenes. Gut Microbes. 2021;13(1):1884517.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Kuroda T, Tsuchiya T. Multidrug efflux transporters in the MATE family. BBA-Proteins Proteom. 2009;1794(5):763–8.

    Article  CAS  Google Scholar 

  27. Rojas-Tapias DF, Helmann JD. Roles and regulation of spx family transcription factors in Bacillus subtilis and related species. Adv Microb Physiol. 2019;75:279–323.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Zhou Y, Wang JQ, Hu CH, Ren LQ, Wang DC, Ye BC. Enhancement of bile resistance by maltodextrin supplementation in Lactobacillus plantarum Lp-115. J Appl Microbiol. 2019;126(5):1551–7.

    Article  CAS  PubMed  Google Scholar 

  29. Srisukchayakul P, Charalampopoulos D, Karatzas KA. Study on the effect of citric acid adaptation toward the subsequent survival of Lactobacillus plantarum NCIMB 8826 in low pH fruit juices during refrigerated storage. Food Res Int. 2018;111:198–204.

    Article  CAS  PubMed  Google Scholar 

  30. Kobayashi K, Ogura M, Yamaguchi H, Yoshida KI, Ogasawara N, Tanaka T et al. Comprehensive DNA microarray analysis of Bacillus subtilis two-component regulatory systems. 2001; 7365–70.

  31. Ogura M, Tanaka T. Recent progress in Bacillus subtilis two-component regulation. Front Biosci. 2002;7(4):d1815–11824.

    Article  CAS  PubMed  Google Scholar 

  32. Zhao S, Zhang Q, Hao G, Liu X, Zhao J, Chen Y, et al. The protective role of glycine betaine in Lactobacillus plantarum ST-III against salt stress. Food Control. 2014;44:208–13.

    Article  CAS  Google Scholar 

  33. Heunis T, Deane S, Smit S, Dicks LM. Proteomic profiling of the acid stress response in Lactobacillus plantarum 423. J Proteome Res. 2014;13(9):4028–39.

    Article  CAS  PubMed  Google Scholar 

  34. Park SS, Kwon HY, Tran TDH, Choi MH, Jung SH, Lee S, et al. ClpL is a chaperone without auxiliary factors. FEBS J. 2015;282(8):1352–67.

    Article  CAS  PubMed  Google Scholar 

  35. Wegkamp A, Mars AE, Faijes M, Molenaar D, de Vos RC, Klaus SM, et al. Physiological responses to folate overproduction in Lactobacillus plantarum WCFS1. Microb Cell Fact. 2010;9:1–14.

    Article  Google Scholar 

  36. Ammam F, Patin D, Coullon H, Blanot D, Lambert T, Mengin-Lecreulx D, et al. AsnB is responsible for peptidoglycan precursor amidation in Clostridium difficile in the presence of Vancomycin. Microbiology. 2020;166(6):567–78.

    Article  CAS  PubMed  Google Scholar 

  37. Sun L, Rogiers G, Courtin P, Chapot-Chartier MP, Bierne H, Michiels CW. AsnB mediates amidation of meso-diaminopimelic acid residues in the peptidoglycan of Listeria monocytogenes and affects bacterial surface properties and host cell invasion. Front Microbiol. 2021;12:760253.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Sun Y, Liu C, Tang W, Zhang D. Manipulation of purine metabolic networks for riboflavin production in Bacillus subtilis. Acs Omega. 2020;5(45):29140–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Arena MP, Capozzi V, Longo A, Russo P, Weidmann S, Rieu A, et al. The phenotypic analysis of Lactobacillus plantarum shsp mutants reveals a potential role for hsp1 in cryotolerance. Front Microbiol. 2019;10:838.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Machielsen R, van Alen-Boerrigter IJ, Koole LA, Bongers RS, Kleerebezem M, Van Hylckama Vlieg JE. Indigenous and environmental modulation of frequencies of mutation in Lactobacillus plantarum. Appl Environ Microb. 2010;76(5):1587–95.

    Article  CAS  Google Scholar 

  41. Moghaddam TK, Zhang J, Du G. UvrA expression of Lactococcus lactis NZ9000 improve multiple stresses tolerance and fermentation of lactic acid against salt stress. J Food Sci Tech Mys. 2017;54:639–49.

    Article  CAS  Google Scholar 

  42. Reuven NB, Arad G, Maor-Shoshani A, Livneh Z. The mutagenesis protein UmuC is a DNA polymerase activated by UmuD’, RecA, and SSB and is specialized for translesion replication. J Biol Chem. 1999;274(45):31763–6.

    Article  CAS  PubMed  Google Scholar 

  43. Russelburg LP, O’Shea Murray VL, Demir M, Knutsen KR, Sehgal SL, Cao S, et al. Structural basis for finding OG lesions and avoiding undamaged G by the DNA glycosylase MutY. Acs Chem Biol. 2019;15(1):93–102.

    Article  PubMed  PubMed Central  Google Scholar 

  44. Serrano LM, Molenaar D, Wels M, Teusink B, Bron PA, De Vos WM, et al. Thioredoxin reductase is a key factor in the oxidative stress response of Lactobacillus plantarum WCFS1. Microb Cell Fact. 2007;6:1–14.

    Article  Google Scholar 

  45. Van Bokhorst-van de Veen H, Bongers RS, Wels M, Bron PA, Kleerebezem M. Transcriptome signatures of class I and III stress response deregulation in Lactobacillus plantarum reveal pleiotropic adaptation. Microb Cell Fact. 2013;12:1–15.

    Article  Google Scholar 

  46. Zhai Z, Yang Y, Wang H, Wang G, Ren F, Li Z, et al. Global transcriptomic analysis of Lactobacillus plantarum CAUH2 in response to hydrogen peroxide stress. Food Microbiol. 2020;87:103389.

    Article  CAS  PubMed  Google Scholar 

  47. Remus DM, van Kranenburg R, van Swam II, Taverne N, Bongers RS, Wels M, et al. Impact of 4 Lactobacillus plantarum capsular polysaccharide clusters on surface glycan composition and host cell signaling. Microb Cell Fact. 2012;11:1–10.

    Article  Google Scholar 

  48. Siezen R, Boekhorst J, Muscariello L, Molenaar D, Renckens B, Kleerebezem M. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria. BMC Genomics. 2006;7:1–13.

    Article  Google Scholar 

  49. Galloway-Peña JR, Liang X, Singh KV, Yadav P, Chang C, La Rosa SL, et al. The identification and functional characterization of WxL proteins from Enterococcus faecium reveal surface proteins involved in extracellular matrix interactions. J Bacteriol. 2015;197(5):882–92.

    Article  PubMed  PubMed Central  Google Scholar 

  50. Grove A. MarR family transcription factors. Curr Biol. 2013;23(4):R142–3.

    Article  CAS  PubMed  Google Scholar 

  51. Grove A. Regulation of metabolic pathways by MarR family transcription factors. Comput Struct Biotec. 2017;15:366–71.

    Article  CAS  Google Scholar 

  52. Desguin B, Goffin P, Bakouche N, Diman A, Viaene E, Dandoy D, et al. Enantioselective regulation of lactate racemization by LarR in Lactobacillus plantarum. J Bacteriol. 2015;197(1):219–30.

    Article  PubMed  Google Scholar 

  53. Mendoza SN, Canon PM, Contreras Á, et al. Genome-scale reconstruction of the metabolic network in Oenococcus oeni to assess wine malolactic fermentation. Front Microbiol. 2017;8:251036.

    Article  Google Scholar 

  54. Liu L, Yu X, Wu M, Zhang K, Shang S, Peng S, et al. Improved tolerance of lactiplantibacillus plantarum in the presence of acid by the heterologous expression of trxA from Oenococcus oeni. Fermentation. 2022;8(9):452.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

The authors thank Professor Hua Wang in Northwest A&F University for kindly providing the O. oeni SD-2a strain.

Funding

This research was funded by the Shandong Natural Science Foundation of Youth project (ZR2022QC171), the National Natural Science Foundation of China (32001659 and 32102002), the Science and Technology Support Plan for Youth Innovation of Colleges and Universities in Shandong Province (2022KJD088), the Taishan Industrial Experts Program, Youth Science and Technology Rising Star Program Project of Binzhou City (QMX2023002), and the Binzhou University Scientific Research Fund Project (BZXYLG2001).

Author information

Author notes

  1. Yujuan Zheng and Yumiao Zhang contributed equally to this work.

Authors and Affiliations

  1. Shandong Provincial Engineering and Technology Research Center for Wild Plant Resources Development and Application of Yellow River Delta, College of Biological and Environmental Engineering, Shandong University of Aeronautics, Binzhou, 256600, China

    Yujuan Zheng, Yumiao Zhang, Yifan Zhao, Xiaoqiu Wu, Huan Wang, Junhua Liu, Bin Liu, Longxiang Liu & Weiyu Song

  2. Shandong Qianfa Agricultural Technology Co., Ltd, Binzhou, 256600, China

    Yumiao Zhang & Longxiang Liu

  3. College of Enology, Northwest A&F University, Xinong Road 22, Yangling, Shaanxi, 712100, China

    Hongyu Zhao

Authors
  1. Yujuan Zheng
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yumiao Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yifan Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Xiaoqiu Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Huan Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Hongyu Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Junhua Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Bin Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Longxiang Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Weiyu Song
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Yujuan Zheng: conceptualization, writing-original draft, and methodology. Yumiao Zhang: methodology and writing-review & editing. Huan Wang: data curation. Xiaoqiu Wu: data curation. Yifan Zhao: formal analysis. Hongyu Zhao: writing-review & editing. Junhua Liu: writing-review & editing. Bin Liu: writing-review & editing. Longxiang Liu: funding acquisition, investigation, methodology, and writing-review & editing. Weiyu Song: funding acquisition, investigation, supervision, and writing-review & editing.

Corresponding authors

Correspondence to Longxiang Liu or Weiyu Song.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zheng, Y., Zhang, Y., Zhao, Y. et al. Heterologous expression of the Oenococcus oeni two-component signal transduction response regulator in the Lactiplantibacillus plantarum WCFS1 strain enhances acid stress tolerance. BMC Microbiol 24, 370 (2024). https://doi.org/10.1186/s12866-024-03498-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12866-024-03498-9

Keywords

BMC Microbiology

ISSN: 1471-2180

Contact us