Skip to main content

Table 1 Primer sequence for RT-qPCR analysis of various genes in S. mutans

From: Quorum quenching of Streptococcus mutans via the nano-quercetin-based antimicrobial photodynamic therapy as a potential target for cariogenic biofilm

Gene Primer Sequence (5′–3′) Product size (bp)a
comA
 Forward TTGTTGGCGCAAAACAATAA 174
 Reverse AATGGTTTCCATCCCATTGA
comB
 Forward CCAGTCCAAACCGTCAGACT 164
 Reverse GCTGCTTTCCTTGTCTTTCG
comDE
 Forward ACAATTCCTTGAGTTCCATCCAAG 81
 Reverse TGGTCTGCTGCCTGTTGC
gtfB
 Forward TGTTGTTACTGCTAATGAAGAA 103
 Reverse GCTACTGATTGTCGTTACTG
16S rRNA
 Forward CCTACGGGAGGCAGCAGTAG 121
 Reverse CAACAGAGCTTTACGATCCGAAA
  1. abp base pair