Skip to main content

Table 2 Forward and reverse primers used for quantitative detection of reference, and immune genes

From: Effects of probiotics on Zebrafish model infected with Aeromonas hydrophila: spatial distribution, antimicrobial, and histopathological investigation

Primer name Sequence Length (Amplicon)
Forward primer d-GAPDH CAGAACATCATCCCAGCCTCC 152 bp
Reverse primer d-GAPDH TTGGCAGGTTTCTCAAGACGG
Forward primer d-IL-1β ACAGCACACACACTGATGCAC 218 bp
Reverse primer d-IL-1β AGAATAAGCAGCACTTGGGGA
Forward primer d-TNF-α TGGATTGTGAACGAAAGTGAG 108 bp
Reverse primer d-TNF-α AGCAATGTTCAGATGTGTTGG