Skip to main content

Table 1 Forward and reverse primers used for detection of both probiotic bacteria through PCR

From: Effects of probiotics on Zebrafish model infected with Aeromonas hydrophila: spatial distribution, antimicrobial, and histopathological investigation

Primer name Sequence Length (Amplicon)
Forward primer L. acidophilus GAAAGAGCCCAAACCAAGTGATT 85 bp
Reverse primer L. acidophilus CTTCCCAGATAATTCAACTATCGCTTA
Forward primer L. delbrueckii CACTTGTACGTTGAAAACTGAATATCTTAA 94 bp
Reverse primer L. delbrueckii CGAACTCTCTCGGTCGCTTT