Skip to main content

Table 2 Strains, plasmids, and primers used in this study

From: A DasA family sugar binding protein Ste2 links nutrient and oxidative stress to exopolysaccharides production in Streptomyces sp. 139

Strains, plasmids, and primers Description Reference
Bacterial strains   
 Streptomyces sp. 139 Ebosin producing strain Our lab
 Streptomyces sp. 139 D2 ste2 knockout mutant of Streptomyces sp.139 This study
 Streptomyces sp. 139 C2 ste2-complemented strain This study
 E. coli DH5α F recA1 endA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1 Δ(lacZYA- argF) U169λ(φ80dlacZΔM15)  
 E. coli ET12567 methylation-deficient E. coli; dam dcm hsdM 44
 E. coli BL21 (DE3) F ompT hsdSB(rB mB) dcm gal λ(DE3) Novagen
Plasmids   
 pKC1139 Shuttle plasmid (E.coli–Streptomyces); pSG5, pBR322; aac[3]IV lacZa oriTRK2; Amr 43
 pKC2D pKC1139 derived plasmid carrying F1, F2 and Kmr fragments; Kmr Amr This study
 pKC2C pKC1139 derived plasmid carrying 0.45-kb ErmE* promoter fragment and ste2; Amr This study
 pGEM-3Zf-ErmE* Resource of ErmE* promoter; Apr 45
 pET30a T7 promoter, His-tag; Kmr Novagen
 pET30a-ste2 pET30a derived plasmid carrying ste2; Kmr This study
Primers   
 P1 (EcoRI) CTGGAATTCGTGCCCTTGCCCTGGAT F1
 P2 (XbaI) GCCTCTAGACTTCGCCTTGGTCTTCT F1
 P3 (XbaI) GCATCTAGAGGCAGCCAGAAGCAGGAAC F2
 P4 (HindIII) AGCAAGCTTACAGGATGGAGCGGAGG F2
 P5 (BamHI) CGCGGATCCATGGGTGCGCAAGGCATT ste2
 P6 (HindIII) CCCAAGCTTTTACTGCTGCTGCGCCAG ste2
 ste5 forward GCTGATCCTGCTGGTGGTGC  
 ste5 reverse CCATCGTGCGGAACTTGAGG  
 ste8 forward CTCGGCAAGCTCAGCCAGAC  
 ste8 reverse CGAGCAGCAGGAACAGCACC  
 ste17 forward CTGGACGGCGACGAGAT  
 ste17 reverse CGACGCAGTGGAACGAG  
 hrdB forward TGGTCGAGGTCATCAACAAG  
 hrdB reverse TGGACCTCGATGACCTTCTC