Skip to main content

Table 2 Primer sequences used in this study

From: Contribution of antimicrobial photo-sonodynamic therapy in wound healing: an in vivo effect of curcumin-nisin-based poly (L-lactic acid) nanoparticle on Acinetobacter baumannii biofilms

Genes Sequences (5́ − 3́) a Amplicon Size (bp) b
csuE F AGTGTATCGCCGGGTGTTTA 113
R AACCCAGGGCTCTCAAAGAA
blsA F ACCTTTAACCCGCTTTTGCT 117
R TCCCCTATTCACCATTCCAA
abaI F TACCCACCACACAACCCTATTT 126
R GCGGTTTTGAAAAATCTACGGC
16S rRNA F AAAGTTGGTATTCGCAACGG 117
R ACCTTTAACCCGCTTTTGCT
  1. Abbreviations: F forward primer, R reverse primer, and bp base pair
  2. a Nucleotides
  3. b Base pair