Skip to main content

Table 2 Primers used in this work

From: The MarR family regulator OsbR controls oxidative stress response, anaerobic nitrate respiration, and biofilm formation in Chromobacterium violaceum

Primer Sequence (5′ - > 3′)
Mutant and overexpressing strains
 CV3905-del1 TAGGGCCCGAAACTGCGGCTCGAACGCC
 CV3905-del2 ATCAAGCTTCATCGAAAGAGTCCCCGTGC
 CV3905-del3 ATCAAGCTTGAAAACACGCCGGCCTGAGC
 CV3905-del4 TTGGATCCCTGGTGGCGGGCTTTGTTGC
 CV_3905-Comp-Fw GGTACCCTGCAGAGCCAGTCCGCATTAAGGCG
 CV_3905-Sup-Rv GGTTACGAGCTCGACGCTCAGCGTCAGAGCTG
Northern blot
 CV0209-NB-Fw TGCAGGTGAAGTTGAGCACCCC
 CV0209-NB-Rv CCGATGAAGCAGGCGGAATAGCC
 NB CV2534 -Fw GATGGTGCTGATCGCGATGG
 NB CV2534 -Rv CCAGGGTCTCGATCAGCATC
 NB CV2541-Fw CCATTCTGTCCGCGCTGTTG
 NB CV2541-Rv GCATTTCGTCCATGTCGCGG
 NB CV3659-Fw CACCTCTGGTGCAGGCTTTC
 NB CV3659-Rv GACAGCGACTGGGTGAACTG
 NB CV0568-Fw ACGCCAAGCTGGGACTCAAC
 NB CV0568-Rv GCTCTACCTCCCGTTCGATG
EMSA
 pCV0209-Fw TTGGATCCTGCCGGAGCGGAATGCAACT
 pCV0209-Rv ATTACTGCAGGCGGTGGCTTCGGCGGTATAC
 pCV3905-Fw GGTACCCTGCAGAGCCAGTCCGCATTAAGGCG
 pCV3905-Rv ATCAAGCTTCATCGAAAGAGTCCCCGT
 pCV0210-Fw CTCGCTGGCCGATCTGGGAC
 pCV0210-Rv GGCGGAATACAGCGCGAAGC
 pCV1486Fw GACCAAGTGATAGACGCCGG
 CV1486-DEL2 GGCCTAAAGCTTCTCGGTCATGAGGATGTCTG
 pCV2087Fw CCTCGTAAAAGCGGATGGCG
 pCV2087Rv CGTCGAAACCCTTCATCGCG
 pCV2534Fw GATCACCGACACCCTCAAGC
 pCV2534Rv GCGACAACACCAGCAGCTTG
 pCV2545Fw TGACTCTCCCCCATTGGGAG
 pCV2545Rv ATCGGGATGCCCAGCACCGC
 pCV3659Fw GACCGACAATGACGGCTACG
 pCV3659Rv GCCGAAATGCAGCACGAAAG
 CV0208 Fw GACCATACTAGACAGCTACGCC
 CV0208Rv CAGCGTGGTGATTTGCGGATAG
  1. Underlined letters indicate restriction enzyme recognition sites used for cloning purposes.