Skip to main content

Table 3 q-RT-PCR Primers

From: Integration of metabolomics and transcriptomics indicates changes in MRSA exposed to terpinen-4-ol

Primer Sequence (5′ → 3′) Length (bp)
pyrB-F AGGCATGGGCTTGCAGAAGAAAC 23
pyrB-R CTCTATTCACAGGTGCCGGATGC 23
pyrF-FpyrF-F ATGGCGTTGTTTGTTCACCTCTTG 24
pyrF-R CGGTGTCGTAATACGGTGTTGGTC 24
carB-F TTAACGTGCCACAGCCACAAGG 22
carB-R TTCCATTGCGCGACCACCTAATAC 24
arcC-F CATGCGGTGGTGGCGGTATTC 21
arcC-R GGTATCTGCTTCAATCAGCGTTGC 24
deoD-F TTACGCTGGTGTCGAAGCATTAGG 24
deoD-R CCCTTTCCTCAGGTGTTGTTGACG 24
16S-F GCTCGTGTCGTGAGATGTTGG 21
16S-R TTTCGCTGCCCTTTGTATTGT 21