Skip to main content

Table 1 The sequence of specific primers used in this study

From: Association of Blastocystis ST6 with higher protease activity among symptomatic subjects

Genes Sequence (5 ‘to 3’) Ref
IFN-ɣ TGACCAGAGCATCCAAAAGA
CTCTTCGACCTCGAAACAGC
[25]
IL-12p35 TTCACCACTCCCAAAACCTGC
GAGGCCAGGCAACTCCCATTA
[26]
IL-8 TGGCTCTCTTGGCAGCCTTC
TGCACCCAGTTTTCCTTGGG
[27]
IL-6 CCTTAAAGCTGCGCAGAATG
ATTCAATGAGGAGACTTGCC
[28]
TNF-α AGCCCATGTTGTAGCAAACC
TGAGGTACAGGCCCTCTGAT
[29]
TGF-β ATGCCCGTATTTATGGAGTT
ATTGTCATTTTGGTCTTGCC
[30]
β-actin ATGTGGCCGAGGACTTTGATT
AGTGGGGTGGCTTTTAGGATG
[31]