Skip to main content

Table 4 Primers used in this study

From: Methicillin-resistant Staphylococcus aureus colonization of infectious and non-infectious skin and soft tissue lesions in patients in Tehran

Primer Sequence (5′ → 3′) Size (bp) Ref.
mecA F: GTGAAGATATACCAAGTGATT
R: ATGCGCTATAGATTGAAAGGA
146 [36]
SCCmec I F: GCTTTAAAGAGTGTCGTTACAGG
R: GTTCTCTCATAGTATGACGTCC
613
SCCmec II F: CGTTGAAGATGATGAAGCG
R: CGAAATCAATGGTTAATGGACC
398
SCCmec III F: CCATATTGTGTACGATGCG
R: CCTTAGTTGTCGTAACAGATCG
280
SCCmec Iva F: GCCTTATTCGAAGAAACCG
R: CTACTCTTCTGAAAAGCGTCG
776
SCCmec IVb F: TCTGGAATTACTTCAGCTGC
R: AAACAATATTGCTCTCCCTC
493
SCCmec IVc F: ACAATATTTGTATTATCGGAGAGC
R: TTGGTATGAGGTATTGCTGG
200
SCCmec IVd F: CTCAAAATACGGACCCCAATACA
R: TGCTCCAGTAATTGCTAAAG
881
SCCmec V F: GAACATTGTTACTTAAATGAGCG
R: TGAAAGTTGTACCCTTGACACC
325
panF F: ATGCACATGGTGCACATGC [37]
agr I-R R: GTCACAAGTACTATAAGCTGCGAT 440
agr II-R R: GTATTACTAATTGAAAAGTGCCATAGC 572
agr III-R R: CTGTTGAAAAAGTCAACTAAAAGCTC 406
agr IV-R R: CGATAATGCCGTAATAC CCG 588
tsst-1 F: TTATCGTAAGCCCTTTGTTG
R: TAAAGGTAGTTCTATTGGAGTAGG
398 [38]
hla-α F: CGGTACTACAGATATTGGAAGC
R: TGGTAATCATCACGAACTCG
744 [38]
psm-a F: TATCAAAAGCTTAATCGAACAATTC
R: CCCCTTCAAATAAGATGTTCATATC
176 [39]
etA F: CTAGTG CATTTGTTATTCAAGACG
R: TGCATTGACACCATAGTACTTATTC
119 [40]
etB F: ACGGCTATATACATTCAATTAATG
R: AAAGTTATTCATTTAATGCACTGTCTC
200 [40]
Int1 F: CCTCCCGCACGATGATC
R: TCCACGCATCGTCAGGC
188 [41]