Skip to main content

Table 6 Primer used in this study for amplification of virulence genes of L. monocytogenes

From: Antimicrobial susceptibility, multilocus sequence typing, and virulence of listeria isolated from a slaughterhouse in Jiangsu, China

Gene Primer Size(bp) Accession number Reference
prfA F:AGCGAGAACGGGACCATC 285 EU372057.1 [33]
R:TTGACCGCAAATAGAGCC
plcA F:CCCAGAACTGACACGAGC 293
R:GCAGCATACTGACGAGG
gyrB F:AGACGCTATTGATGCCGATGA 91
R:GTATTGCGCGTTGTCTTCGA
plcB F:ATTAACCAAACCACTGGCTCA 502 [41]
R:TTGATAAGCAGTCTGGACAAT
inlA F:ATAAGTGATATAAGCCCAG 606
R:TTTATCCGTACTGAAATTCC
hly F:GTTGCAAGCGCTTGGAGTGAA 420
R:ACGTATCCTCCAGAGTGATGG
sigB F:CCAAAAGTATCTCAACCTGAT 642
R:CATGCATTTGTGATATATCGA