Skip to main content

Table 5 Primer used in this study for amplification of resistance genes of the Listeria spp

From: Antimicrobial susceptibility, multilocus sequence typing, and virulence of listeria isolated from a slaughterhouse in Jiangsu, China

Category Gene Primer Size
(bp)
Accession number Reference
Tetracycline tetA F:GCTACATCCTGCTTGCCTTC 220 NG_048154.1 [8, 28]
R:CATAGATCGCCGTGAAGAGG  
tetM F:GTGGACAAAGGTACAACGAG 974 NC_013929.1
R:CGGTAAAGTTCGTCACACAC  
tetS F:CATAGACAAGCCGTTGACC 1050 NC_013929.1
R:ATGTTTTTGGAACGCCAGAG  
Aminoglycosides aac(6′)-Ib F:TTGCGATGCTCTATGAGTGGCTA 544 NZ_CP016990.1 [8]
R:CTCGAATGCCTGGCGTGTTT  
Macrolides ermA F:AAGCGGTAAAACCCCTCGAG 651 MH_830363.1
R:TCA AAGCCTGTCGGATTGG  
ermB F:GAAAAGGTACTCAACCAAATA 639 NG_047798.1
R:CATTTGTTAAATTCATGGCAATGA  
ermC F:TCAAAACATAATATAGATAAA
R:GCTAATATTGTTTAAATCGTCAAT
641 NG_047806.1
ESBLs mecA F:TAGAAATGACTGAACGTCCG 154 NG_047937 [29]
R:TTGCGATCAATGTTACCGTAG  
Vancomycin van A F:GGGAAA ACGACAATTGC 732 NC_011916.1 [8]
R:GTACAA TGCGGCCGTTA  
van B F:TTGATGTGGCTTTCCCGGTT 544 NC_011916.1
R:ACCCGATTTCGTTCCTCGAC  
Multi-drugefflux
pump gene
cfr F:CGATTTGAGGATATGAAGGTTCT 416 NG_047631.1 [16]
R:AAATTAGGATCCGTAAACGAAT