Skip to main content

Table 3 Primers used in this study

From: Increased gene expression and copy number of mutated blaKPC lead to high-level ceftazidime/avibactam resistance in Klebsiella pneumoniae

Genes Sequence 5′-3′ Reference
KPC-F GGCCGCCGTGCAATAC [38]
KPC-R GCCGCCCAACTCCTTCA [38]
RPOB-F CTGATGCCTCAGGATATGATCAAC [38]
RPOB-R CTGGCTGGAACCAAAGAACTCT [38]
OmpK35-F TCCCTGCCCTGCTGGTAG [36]
OmpK35-R CTGGTGTCGCCATTGGTGG [36]
OmpK36-F GCGACCAGACCTACATGCGT [36]
OmpK36-R AGTCGAAAGAGCCCGCGTC [36]