Skip to main content

Table 5 Oligonucleotide Primers for polysaccharide capsular typing

From: Prevalence and molecular characterization of group B streptococcus in pregnant women from hospitals in Ohangwena and Oshikoto regions of Namibia

Primer Target Primer sequence Size bp
Ia-F cps1aH 5′ – GGTCAGACTGGATTAATGGTATGC – 3′ 521 & 1826 bp
Ia-R cps1Ah 5′ – GTAGAAATAGCCTATATACGTTGAATGC – 3′
Ib-F cps1bJ 5′ – TAAACGAGAATGGAATATCACAAACC – 3′ 770 bp
Ib-R cpsIbK 5′ – GAATTAACTTCAATCCCTAAACAATATCG – 3’
II-F cps2K 5′ – GCTTCAGTAAGTATTGTAAGACGATAG – 3’ 397 bp
II-R cps2K 5′ – TTCTCTAGGAAATCAAATAATTCTATAGGG – 3’
III-F cps1a/2/3I 5′ – TCCGTACTACAACAGACTCATCC – 3’ 1826 bp
III-R cps1a/2/3 J 5′ – AGTAACCGTCCATACATTCTATAAGC – 3’
IV-F cps4N 5′ – GGTGGTAATCCTAAGAGTGAACTGT – 3’ 578 bp
IV-R cps4N 5′ – CCTCCCCAATTTCGTCCATAATGGT – 3’
V-F cps5O 5′ – GAGGCCAATCAGTTGCACGTAA – 3’ 701 bp
V-R cps5O 5′ – AACCTTCTCCTTCACACTAATCCT – 3’
VI-F cps6I 5′ – GGACTTGAGATGGCAGAAGGTGAA – 3’ 487 bp
VI-R cps6I 5′ – CTGTCGGACTATCCTGATGAATCTC – 3’
VII-F cps7M 5′ – CCTGGAGAGAACAATGTCCAGAT – 3’ 371 bp
VII-R cps7M 5′ – GCTGGTCGTGATTTCTACACA – 3’
VIII-F cps8J 5′ – AGGTCAACCACTATATAGCGA – 3’ 282 bp
VIII-R cps8J 5′ – TCTTCAAATTCCGCTGACTT – 3’