Skip to main content

Table 4 Oligonucleotide primers used in multiplex PCR for gene based resistance testing

From: Prevalence and molecular characterization of group B streptococcus in pregnant women from hospitals in Ohangwena and Oshikoto regions of Namibia

Primer Target Primer sequence 5′ – 3’ Size
tetmS – F tet(M) GTCTTGCATATATACGCCTTTATAGTGGAGTACTACATTTACGAG 374 bp
tetmA – R tet(M) CCACGTAATATCGTAGAAGCGGATCACTATCTGAG
tetoS – F tet(O) CGTATATATAGCGGAACATTGCATTTGAGGG 548 bp
tetoA – R tet(O) CGGCTCTATGGACAACCCGACAGAAG