Skip to main content

Table 2 Bacterial strains, plasmids, and oligonucleotides

From: A new, reliable, and high-throughput strategy to screen bacteria for antagonistic activity against Staphylococcus aureus

Bacteria, plasmid, oligonucleotides Relevant characteristic(s) or sequence Source
Bacterial strains
 E. coli DH5αλpir Plasmid cloning strain [21]
 S. aureus RN4220 Restriction deficient strain, partially defective AgrA [43]
 S. aureus 10400326 or Sa2 ST351, AIP-II producer [44]
 S. aureus 10303344 or Sa25 ST352, AIP-I producer [44]
 S. aureus 41000044 or Sa27 ST151, AIP-II producer [44]
 S. aureus 21000024 or Sa30 ST352, AIP-I producer [44]
 L. lactis subsp. lactis ATCC 11454 Nisin producer [45]
 S. epidermidis ATCC 14990 AIPep-I producer [46]
Plasmids
 pBGR1 Promoter trap vector [47]
 pKK30 Highly stable plasmid containing PsarAP1-dfrA [21]
 pQS1 pKK30 containing PagrP3-gfpbk This study
 pQS3 pKK30 containing PagrP3-mCherry This study
Primers
 AGRP3-F3 (EcoRI) AAAGAATTCGTAATTTGTATTTAATATTTTAAC This study
 AGRP3-F4 (NheI) AAAGCTAGCGTAATTTGTATTTAATATTTTAAC This study
 AGRP3-R1 (BamHI) AAAGGATCCCAACTATTTTCCATCAC This study
 GFP-R1 (EcoRV) AAAGATATCTTATTTGTAGAGCTC This study
 mCherry-R1 (BamHI) AAAGGATCCCTACTTGTACAGCTC This study