Skip to main content

Table 3 Primers used for identification of virulence factors genes, SCCmec types, real-time PCR of β-lactamase and virulence regulatory genes BSI collection of S. aureus

From: Regulation of virulence and β-lactamase gene expression in Staphylococcus aureus isolates: cooperation of two-component systems in bloodstream superbugs

Genes Primers Ref
tst F: TTCACTATTTGTAAAAGTGTCAGACCCACT
R: TACTAATGAATTTTTTTATCGTAAGCCCTT
[12]
etA F: ACTGTAGGAGCTAGTGCATTTGT
R: TGGATACTTTTGTCTATCTTTTTCATCAAC
[12]
etB F: CAGATAAAGAGCTTTATACACACATTAC
R: AGTGAACTTATCTTTCTATTGAAAAACACTC
[12]
lukS-PVL F: ATCATTAGGTAAAATGTCTGGACATGATCCA
R: GCATCAASTGTATTGGATAGCAAAAGC
[12]
LukE-LukD F: TGAAAAAGGTTCAAAGTTGATACGAG
R: TGTATTCGATAGCAAAAGCAGTGCA
[12]
lukM F: TGGATGTTACCTATGCAACCTAC
R: GTTCGTTTCCATATAATGAATCACTAC
[12]
edinA F: GAAGTATCTAATACTTCTTTAGCAGC
R: TCATTTGACAATTCTACACTTCCAAC
[12]
hla F: CTGATTACTATCCAAGAAATTCGATTG
R: CTTTCCAGCCTACTTTTTTATCAGT
[12]
hlb F: GTGCACTTACTGACAATAGTGC
R: GTTGATGAGTAGCTACCTTCAGT
[12]
hld F: AAGAATTTTTATCTTAATTAAGGAAGGAGTG
R: TTAGTGAATTTGTTCACTGTGTCGA
[12]
hlg F: GTCAYAGAGTCCATAATGCATTTAA
R: CACCAAATGTATAGCCTAAAGTG
[12]
SCCmecI F: GCTTTAAAGAGTGTCGTTACAGG
R: GTTCTCTCATAGTATGACGTCC
[4]
SCCmecII F: CGTTGAAGATGATGAAGCG
R: CGAAATCAATGGTTAATGGACC
[4]
SCCmecIII F: CCATATTGTGTACGATGCG
R: CCTTAGTTGTCGTAACAGATCG
[4]
SCCmecIV F: GCCTTATTCGAAGAAACCG
R: CTACTCTTCTGAAAAGCGTCG
[4]
SCCmecV F: GAACATTGTTACTTAAATGAGCG
R: TGAAAGTTGTACCCTTGACACC
[4]
mecRI F: TGGTATTTGGTTTAGTGAA
R: GATTAGGTTTAGGCATTGA
[32]
mecI F: AATGGCGAAAAAGCACAACA
R: GACTTGATTGTTTCCTCTGTT
[32]
blaz F: AAGAGATTTGCCTATGCTTC
R: GCTTGACCACTTTTATCAGC
[33]
mecA F: AAAGAACCTCTGCTCAACAAGT
R: TGTTATTTAACCCAATCATTGCTGTT
[33]
RNAII F: TATGAATAAATGCGCTGATGATATACCACG
R: TTTTAAAGTTGATAGACCTAAACCACGACC
[34]
RNAIII F: GCCATCCCAACTTAATAACCA
R: TGTTGTTTACGATAGCTTACATGC
[34]
sarA F: TCTTGTTAATGCACAACAACGTAA
R: TCTTGTTAATGCACAACAACGTAA
[34]
agrA F: ATGCACATGGTGCACATGC
R: GTCACAAGTACTATAAGCTGCGAT
[11]
agrB F: ATGCACATGGTGCACATGC
R: GTATTACTAATTGAAAAGTGCCATAGC
[11]
agrC F: ATGCACATGGTGCACATGC
R: CTGTTGAAAAAGTCAACTAAAAGCTC
[11]
agrC F: ATGCACATGGTGCACATGC
R: CGATAATGCCGTAATACCCG
[11]
seaRS F: GCTCATGCTTCTGAGCAAGA
R: CTAATACGACTCACTATAGGGAGA
[14]
gmk F: TCGTTTTATCAGGACCATCTGGAGTAGGTA
R: CATCTTTAATTAAAGCTTCAAACGCATCCC
[34]