Skip to main content

Table 1 In silico assessment of SaQuant and other S. aureus-specific assays

From: SaQuant: a real-time PCR assay for quantitative assessment of Staphylococcus aureus

Assay S. aureus hits (n= 1818) Other Staphylococci hits (n= 1834) Sensitivity Specificity Reference Forward Reverse Probe Amplicon size
SaQuant 1738 1 95.60 99.95 This one AACTACTAGGGGAGCCTAATRAT GGTACTAACCAAATCAGGTCATAA TGGCTGAGATGAAYTGTTCAGACCC 73
1 898 1 49.39 99.95 [27] GGCATATGTATGGCAATTGTTTC CGTATTGCCCTTTCGAAACATT ATTACTTATAGGGATGGCTATC 73
2 0 0 0 100 [23] CAAAGCATCAAAAAGGTGTAGAGA TTCAATTTTCTTTGCATTTTCTACCA TTTTCGTAAATGCACTTGCTTCAGGACCA Unknown
3 753 6 41.42 99.67 [28] CAGCAAACCATGCAGATGCTA CGCTAATGATAATCCACCAAATACA TCAAGCATTACCAGAAAC 101
4 1780 11 97.91 99.40 [29] AACTGTTGGCCACTATGAGT CCAGCATTACCTGTAATCTCG   306
5 1499 0 82.45 100 [30] GCGATTGATGGTGATACGGTT AGCCAAGCCTTGACGAACTAAAGC GGTGTAGAGAAATATGGTCCTGAAGCAAGTGCA 279
6a 1318 1 72.50 99.95 [31] AATCTTTGTCGGTACACGATATTC CGTAATGAGATTTCAGTAGATAATACAACA   108
7 117 0 6.44 100 [32] AGTGAGCGACCATACAACAG CATAATTCCCGTGACCATTT AAGCACAAGGACCAATCGAGG 185
femB 1010 0 55.56 100 [33] TTACAGAGTTAACTGTTACC ATACAAATCCAGCACGCTCT   651
  1. aModified sequence to exclude the last 3 nucleotides as the published sequence is not predicted to amplify any S. aureus genomes