Skip to main content

Table 6 qPCR primers used in this study

From: Increased whiB7 expression and antibiotic resistance in Mycobacterium chelonae carrying two prophages

Target Primers Sequence (5' to 3') Tm (˚C) % GC amplicon size (bp)
Forward and reverse primers targeting whiB7 (BB28_RS17590) WhiB7_qPCR_F4 ACTTTCCGCGAACCACAG 55.6 55.6 81
WhiB7_qPCR_R1a ATGATGACCGTCGAAGTGG 54.6 52.6
Forward and reverse primers targeting 16s rRNA (BB28_RS07070) Myco_16S_F1 CCGGATAGGACCACACACTT 56.6 55 91
Myco_16S_R1 ATTACCCCACCAACAAGCTG 55.4 50