Skip to main content

Table 2 Primers used for RT-qPCR

From: The small molecule ZY-214-4 may reduce the virulence of Staphylococcus aureus by inhibiting pigment production

Primer name Sequence (5′–3′)
gyrb-RT-F ACATTACAGCAGCGTATTAG
gyrb-RT-R CTCATAGTGATAGGAGTCTTCT
sodA-RT-F GACAGACATCATAACACTTA
sodA-RT-R ACTCCCAGAATAATGAATG
sodM-RT-F CTGTACCTTCTACTGCAGCATTTA
sodM-RT-R TTAGAACCACATTTTGACAAAGAA
crtM-RT-F CATCGTATGTCTGATGTG
crtM -RT-R GCTGAATTATTCGGATATTG