Skip to main content

Table 3 Newly designed primers and clone libraries generated using these primers for sample S1

From: Design of targeted primers based on 16S rRNA sequences in meta-transcriptomic datasets and identification of a novel taxonomic group in the Asgard archaea

Target Forward_primer Reverse_primer Annealing (°C) Results of clone library
Type A 21AF: CTCTAGTTGATCCTGCTAGA 1492R-22 W: TACGG(A/T)TACCTTGTTACGACTT 47 Euryarchaeota (26/28) b
26AF: GG(A/G)CACTGCTATCGGCTT 52 Unclassified (14/14)
59AF: AAGTCGAACGGACACGCAT 52 - a
Type B 12BF: CGATCCTGACGGAGCCTA 1492R: GGTTACCTTGTTA(C/T)GACTT 45
15BF: ATCCTGACGGAGCCTA 45
16BF: TCCTGACGGAGCCTAC 45
17BF: CCTGACGGAGCCTACT 50 Crenarchaeota (11/13)
26BF: GCCTACTGCTATCGGATT 45 Thaumarchaeota (8/10)
27BF: CCTACTGCTATCGGATT 45 Unclassified (8/9)
Type A and Type B 26ABF: G(G/C)(G/A/C)(C/T)ACT
GCTATCGG(A/C)TT
1492R: GGTTACCTTGTTA(C/T)GACTT 50 Unclassified (39/100)
  1. a There were no obvious 16S rRNA gene bands after amplification
  2. b Abundance of the majority microorganisms in clone results