Skip to main content

Table 3 Newly designed primers and clone libraries generated using these primers for sample S1

From: Design of targeted primers based on 16S rRNA sequences in meta-transcriptomic datasets and identification of a novel taxonomic group in the Asgard archaea

Target

Forward_primer

Reverse_primer

Annealing (°C)

Results of clone library

Type A

21AF: CTCTAGTTGATCCTGCTAGA

1492R-22 W: TACGG(A/T)TACCTTGTTACGACTT

47

Euryarchaeota (26/28) b

26AF: GG(A/G)CACTGCTATCGGCTT

52

Unclassified (14/14)

59AF: AAGTCGAACGGACACGCAT

52

- a

Type B

12BF: CGATCCTGACGGAGCCTA

1492R: GGTTACCTTGTTA(C/T)GACTT

45

15BF: ATCCTGACGGAGCCTA

45

16BF: TCCTGACGGAGCCTAC

45

17BF: CCTGACGGAGCCTACT

50

Crenarchaeota (11/13)

26BF: GCCTACTGCTATCGGATT

45

Thaumarchaeota (8/10)

27BF: CCTACTGCTATCGGATT

45

Unclassified (8/9)

Type A and Type B

26ABF: G(G/C)(G/A/C)(C/T)ACT

GCTATCGG(A/C)TT

1492R: GGTTACCTTGTTA(C/T)GACTT

50

Unclassified (39/100)

  1. a There were no obvious 16S rRNA gene bands after amplification
  2. b Abundance of the majority microorganisms in clone results