Table 6 The genes, primer sequence, cycling condition and reference for fragilysin bft gene, fpn, bfp1–4 genes and cfiA carbapenemase gene
Gene | Primer sequence (5′ to 3′) | Cycling condition | Product size (bp) | Reference |
|---|---|---|---|---|
bft | bftF: CGAACTCGGTTTATGCAGTT bftR: GGATACATCAGCTGGGTTGT | 95 °C/5 min; followed by 35 cycles of 95 °C/45 s, 56 °C /1 min, 72 °C/45 s, 72 °C/ 7 min | 295 | [18] |
fpn | C11_protease_F: ATTCGGCCGATGCAAATGTG C11_protease_R: CGGAATCTCGGTAGGGAAC | 95 °C 5 min; followed by 35 cycles of 95 °C/45 s; 56 °C /1 min; 72 °C/45 s, 72 °C/7 min | 290 | [11] |
bfp1 | C10_protease_F1: GCGGTGAACAAAGAACGACA C10_protease_R1: TCGCCTGAGCAACTGCAATA | 95 °C 10 min; 35 cycles of 95 °C/15 s; 59 °C/30s; 72 °C/47 s; 72 °C/7 min | 153 | [11] |
bfp2 | C10_protease_F2: CGTACCAATTGCAATTGCGC C10_protease_R2: AGCTCCCGTGGCTTTATCTT | 95 °C 10 min; 35 cycles of 95 °C/15 s; 59 °C/30 s; 72 °C/47 s; 72 °C/7 min | 178 | [11] |
bfp3 | C10_protease_F3: TTTGGAGTAGCAGCAGCAGA C10_protease_R3: TTTCTGGTTTCGGGTGTTTC | 95 °C 10 min; 35 cycles of 95 °C/15 s; 59 °C/30 s; 72 °C/47 s; 72 °C/7 min | 194 | [11] |
bfp4 | C10_protease_F4: TACAACGGTGTTGGTGCAAG C10_protease_R4: ACACAAATGCGCCACTTCAT | 95 °C 10 min; 35 cycles of 95 °C/15 s; 59 °C/30s; 72 °C/47 s; 72 °C/7 min | 126 | [11] |
cfiA | cfiF: AATCGAAGGATGGGGTATGG cfiR: CGGTCAGTGAATCGGTGAAT | 95 °C/10 min, followed by 35 cycles of 95 °C/15 s, 59 °C/30s, 72 °C/ 7 s; 72 °C/7 min | 302 | [38] |