First insights into the molecular basis association between promoter polymorphisms of the IL1B gene and Helicobacter pylori infection in the Sudanese population: computational approach

Table 5 Summary of the in silico predicted CE for the [−368_ + 10] region

CE	MatrixName for a 1st element	S₁	Distance in between	MatrixName for a 2nd element	S₂	Position^a	orientation	CS	P-Value	Sequence
CE00047	V$POU1F1_Q6	0.935	−1	V$OCT1_04	0.949	− 239	–	−0.004	7.72e-06	ATGCATATTTGCATGGTGATAC
CE00058	V$NFKB_Q6_01	0.937	5	V$HMGIY_Q6	0.995	− 300	+	−0.46	1.22e-05	ACGTGGGAAAAT
CE00158	V$OCT_C	0.907	10	V$AP1_01	0.869	−236	–	−0.232	1.88e-04	CATATTTGCATGGTGATACATTT
CE00058	V$NFKB_Q6_01	0.791	6	V$HMGIY_Q6	0.995	− 301	+	−0.181	1.05e-03	AACGTGGGAAAAT
CE00186	V$ETS_Q6	0.936	13	V$CEBPA_01	0.942	−107	–	−1.049	6.55e-03	CTTTCCTTTaactTGATTGTGAAATCA
CE00249	V$IRF_Q6	0.924	5	V$PU1_Q6	0.839	− 111	+	−0.314	1.01e-02	TCCCCTTTCCTTT
CE00078	V$GR_Q6	0.914	39	V$CEBPB_02	0.799	− 377	+	0.049	2.37e-02	GAAGAAAAGTATGTGCATGTataaatctgtgtgtcttccACTTTGTCCCACAT
CE00186	V$ETS_Q6	0.896	20	V$CEBPA_01	0.942	− 120	–	−0.793	2.73e-02	TTTTCCCCTttcctttaactTGATTGTGAAATCA
CE00135	V$ETS_Q6	0.781	25	V$MYB_Q5_01	0.974	− 292	–	0.002	4.31e-02	AAATCCAGTattttaatgtggacatCAACTGCAC

CE Composite regulatory element, S_1,2 PWM scores for the first and second elements, CS Composite score
^aBeginning of the element relative to TSS

ISSN: 1471-2180