Skip to main content

Table 5 Summary of the in silico predicted CE for the [−368_ + 10] region

From: First insights into the molecular basis association between promoter polymorphisms of the IL1B gene and Helicobacter pylori infection in the Sudanese population: computational approach

CE MatrixName for a 1st element S1 Distance in between MatrixName for a 2nd element S2 Positiona orientation CS P-Value Sequence
CE00047 V$POU1F1_Q6 0.935 −1 V$OCT1_04 0.949 − 239 −0.004 7.72e-06 ATGCATATTTGCATGGTGATAC
CE00058 V$NFKB_Q6_01 0.937 5 V$HMGIY_Q6 0.995 − 300 + −0.46 1.22e-05 ACGTGGGAAAAT
CE00158 V$OCT_C 0.907 10 V$AP1_01 0.869 −236 −0.232 1.88e-04 CATATTTGCATGGTGATACATTT
CE00058 V$NFKB_Q6_01 0.791 6 V$HMGIY_Q6 0.995 − 301 + −0.181 1.05e-03 AACGTGGGAAAAT
CE00186 V$ETS_Q6 0.936 13 V$CEBPA_01 0.942 −107 −1.049 6.55e-03 CTTTCCTTTaactTGATTGTGAAATCA
CE00249 V$IRF_Q6 0.924 5 V$PU1_Q6 0.839 − 111 + −0.314 1.01e-02 TCCCCTTTCCTTT
CE00078 V$GR_Q6 0.914 39 V$CEBPB_02 0.799 − 377 + 0.049 2.37e-02 GAAGAAAAGTATGTGCATGTataaatctgtgtgtcttccACTTTGTCCCACAT
CE00186 V$ETS_Q6 0.896 20 V$CEBPA_01 0.942 − 120 −0.793 2.73e-02 TTTTCCCCTttcctttaactTGATTGTGAAATCA
CE00135 V$ETS_Q6 0.781 25 V$MYB_Q5_01 0.974 − 292 0.002 4.31e-02 AAATCCAGTattttaatgtggacatCAACTGCAC
  1. CE Composite regulatory element, S1,2 PWM scores for the first and second elements, CS Composite score
  2. aBeginning of the element relative to TSS