Skip to main content

Table 1 Primers used in qPCR studies

From: Development of a real-time quantitative PCR method for detection and quantification of Prevotella copri

Primer name Sequence #nucleotides Amplicon length (bp) Target gene Reference
Universal 16S, F ACTCCTACGGGAGGCAGCAGT 21 192 16S rRNA Scher et al., 2013 [12]
Universal 16S, F ATTACCGCGGCTGCTGGC 18   
P. copri genus 16S, F CACRGTAAACGATGGATGCC 20 516 16S rRNA Matsuki et al., 2002
P. copri genus 16S, R GGTCGGGTTGCAGACC 16   
P. copri genome specific, F CCGGACTCCTGCCCCTGCAA 20 106 FimB/Mfa2 family fimbrial subunit Scher et al., 2013 [12]
P. copri genome specific, R GTTGCGCCAGGCACTGCGAT 20 PREVCOP_RS00015  
P. copri 16S, 1F ACATCGAAAGCTTGCTTTTG 20 409 16S rRNA This publication
P. copri 16S, 1R CAAAAAGCCTCACGAGGCTC 20 AB064923  
P. copri 16S, 2F ACCACTTGGGGATAACCTTG 20 347 16S rRNA This publication
P. copri 16S, 2R TACATGCAAAAAGCCTCACGAGGC 24 AB064923  
P. copri 16S, 3F TCTCTAGAAGACATCTGAAAGA 22 446 16S rRNA This publication
P. copri 16S, 3R CAGTGCAGACGTTGAGCGT 19 AB064923  
P. copri16S, 4F CGAAAGCTTGCTTTTGATGG 20 86 16S rRNA This publication
P. copri 16S, 4R CGCAAGGTTATCCCCAAGT 19 AB064923  
P. copri genome specific, 1F TTTTGCTGTAGGAGGGGTTG 20 96 glycosyl transferase, group 1 This publication
P. copri genome specific, 1R GGGCTGCATAAAGCAAAGAC 20 PREVCOP_06806  
P. copri genome specific, 2F AGCCGAGATATCGTGAGTGG 20 137 RNA polymerase ECF-type sigma factor This publication
P. copri genome specific, 2R TGAACAGCTGTATGCCGAAG 20 PREVCOP_06715  
P. copri genome specific, 3F AGTTTGTCAATGCCCTCCTG 20 141 CAAX amino protease family protein This publication
P. copri genome specific, 3R CATCGCTCTGAGGCATGATA 20 PREVCOP_06538  
P. copri genome specific, 4F TCGCTGACATGAGCGATAAC 20 109 metalloprotease domain protein, M6 family This publication
P. copri genome specific, 4R CCGTTGGCACTACCTTCATT 20 PREVCOP_04242