Skip to main content

Table 2 Primers and probe sequences targeting ITS-2 region of ribosome DNA in A. tetraptera

From: Standardization of an LNA-based TaqMan assay qPCR analysis for Aspiculuris tetraptera DNA in mouse faeces

Primer/Probe Sequence Tm (°C) Product size (bp)
Normal oligo primer Fw ATACTCTTTGACGCATACACAC 58.2 75
Normal oligo primer Rv CAGCCATAGGTATTGTTATATGAGC 61.4
LNA oligo primer Fw ATACTCTTTGACGCATACACAC 63 75
LNA oligo primer Rv CAGCCATAGGTATTGTTATATGAGC 63
LNA TaqMan probe FAM/CATACACACCGTATATGTGTTGC/3IABkFQ 57
  1. Bold letters with underline indicates LNA-modified bases