Skip to main content

Table 5 Names and sequences of primers used in this study

From: Antimicrobial resistance and metallo-beta-lactamase producing among commensal Escherichia coli isolates from healthy children of Khuzestan and Fars provinces; Iran

Primer name Sequence (5′ → 3′) References
blaIMP-1F ACCGCAGCAGAGTCTTTGCC [13]
blaIMP-1R ACAACCAGTTTTGCCTTACC
blaIMP-2F GTTTTATGTGTATGCTTCC [13]
blaIMP-2R AGCCTGTTCCCATGTAC
blaVIM-1F AGTGGTGAGTATCCCGACAG [39]
blaVIM-1R ATGAAAGTGCGTGGAGAC
blaVIM-2F ATGTTCAAACTTTTGAGTAAG [41]
blaVIM-2R CTACTCAACGACTGAGCG
blaSPM-1F GCGTTTTGTTTGTTGCTC [13]
blaSPM-1R TTGGGGATGTGAGACTAC
blaGIMF TCGACACACCTTGGTCTG [40]
blaGIMR AACTTCCAACTTTGCCAT
blaSIMF TACAAGGGATTCGGCATCC [40]
blaSIMR TAATGGCCTGTTCCCATG
blaNDMF GGCGGAATGGCTCATCACGA [43]
blaNDMR CGCAACACAGCCTGACTTTC
BlaKPC-F ‘ATGTCACTGTATCGCCGTCT [44]
blaKPC-R ‘TTTTCAGAGCCTTACTGCCC
oxa-23-F AAGCATGATGAGCGCAAAG [45]
oxa-23-R AAAAGGCCCATTTATCTCAAA
oxa-48-F TTGGTGGCATCGATTATCGG [46]
oxa-48-R GAGCACTTCTTTTGTGATGGC
uspA-F CCGATACGCTGCCAATCAGT [37]
uspA-R ACGCAGACCGTAGGCCAGAT