Skip to main content

Table 2 Primers used in this study

From: Role of aspartate ammonia-lyase in Pasteurella multocida

Primer Sequence 5′- 3’ RE
aspAU1 CGGGGTACCCCCTAATGCAGAAGTAATTAA KpnI
aspAU2 CCTGCAGGATGCGGCCGCGCATTTCGAGTGATGAACAAGT PstI/NotI
aspAD1 CGCGGCCGCATCCTGCAGGATAACTGTTAATTTAACCGCA NotI/PstI
aspAD2 CGCGAGCTCAGCGTGTAAGCAATATTTTAG SacI
Kan-F1 ATAAGAATGCGGCCGCTCAGTGGAACGAAAACTC NotI
Kan-F2 TGCACCTGCAGGTTAGAAAAACTCATCGAGCATC PstI
aspA1 ATGACAGTAACAAGAAAAGAAGT
aspA2 TTATTTATTCAACTTCGCTTTATAG
T1 TTCGGCATTTAGCAAACTGACGACG
T2 GGTGTCACACTTCCGTGCGTTAGAG
CaspA1 CGCGGATCCTTTAATGATACAAGGGCTATGCTCA BamH I
CaspA2 GGCGTCGACTTATTTATTCAACTTCGCTTTATAGG Sal I
M1 GAAGAGTGCAGTTGGCTTGCG
M2 AAATCGCGAGGAATACTGACG
qaspA1 TTGTGGGGCGTATGTGATGG
qaspA2 ACTGGGTTGACTTTTGCTGGC
q16s rRNA1 TCACCGCAACATTCTGATTT
q16s rRNA2 CATACAGAGGGCAGCGAGA
  1. Restriction endonuclease (RE) cleavage sites introduced into primers are underlined